GenePrediction:GLEAN_5422 Details

Name: GLEAN_5422
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:761580..755773 (- strand)
Length: 5808
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:761580..761113 (- strand)
Length: 468
Type: CDS
Source: GLEAN
Position: GCSC_132:761042..756219 (- strand)
Length: 4824
Type: CDS
Source: GLEAN
Position: GCSC_132:756108..755949 (- strand)
Length: 160
Type: CDS
Source: GLEAN
Position: GCSC_132:755885..755773 (- strand)
Length: 113
>GLEAN_5422 class=GenePrediction position=GCSC_132:761580..755773 (- strand)
ATGGCTTCGCAGCAGGATGGAAGTCCGGTCACGCCCACACCGCTGCAGCGGCATTCCGGCGTCGACCGGTCGTCGTTCTC
CCTTCACCCACCCCGCCTGAGCATCGGTTCAGGCCACCATTATCGCTTCGCCGACTTTGACGAGGGGTCCTTTTCCGAAA
GTGCAGGCGTCTCGGCCGAGCAGGCCAAGCGTGCTCTGCGGGCACACCTCGCTGAGACCGAGCGACGCATGGCCGAGGCT
GGGCGCCTGGGAACTGCACTTGTTCAACAACAGAAAGAGTTGACGGAGAAGCTGCAAGAAGTCGAGACGCTGCAAGAAGA
ATCCGAGTTGTCACCAGAACTCAAGAAGAAGCTCGCCGAGCTAGAGAAGGAGTATGACGATGTGGCCCGAGAAACCGCTC
GTGCTTTCCTACCGAAGAAGCGTGTTCCTAGCAATGAATCTACTGACTCGCCGGATGCGAGAGGTCGGGTACGTTTCCAC
CGCTGCATACACTCTTCCCTGGCCATTGCCCTGGGTCCCGTCTGCTAATGAGCCACAGAGATCTTTGAGTCCTTCTAAAT
ACGAGACCCATGCCTCCGGATCGCCTAGCAAGTTGACTGTCTCGAACCGCAGACAGCGGAACCAAAACTCCAACCGGGTT
CACGACATTGAGTTCGCTGCGGAAATTAGCACGTCGCTGATCTCGCAGGTTCGTGGGCTGCAGGCACTTTTGGCTGAGCG
GGAGGAAGATTTGCGCGATACAAAGCAGGACCTTGCTCGGCTGGAAGACACTGCGGATACGATGCGTGAGCGTATCAAAG
AACTGGACGAAGGCGAGCATCGCTACAAAGAGGAGAACTGGAATCTGGAAACCCGCATCCACGACCTGGATGCTGCCCAA
CGTGACGCCTCCGACAAGGATAAAAAAATGGCTCAGCAACTGGCGATTCTGCAGGCCGACAAGGTCAAGACGCAGCGGGA
ACTCGATGAACTGAAGGGCGTGCACGCTCGTCTGGTTGATGAGCACGCTGCGATCGTCAAGCTCAATGACATCGAACTCG
GTACAGCGAAGCGGAGCATCATCTTGGCTGATGGTGAAAAGGCCACGATGCAGCGCAAGATTGACGAACTGACAGGACTC
AACCAAGAACTTGCTCGTGCCGTCTCGATGCAGCAGCGTGTCCAATCCGTCATTGGCGAAGCTGTCCCTGCAAAGAGCGA
CGAGGACGCTGATACTTCCAACGACCAGGGCACGCCCGATCACTCGCCACCTGCCTCTCCAGTCAAGGGCACGCCTCGCC
ATCCTGGTCTCGAGACGGAAACTTTGAAAACGTCCCTCCTCCACGCCCAACGCACTGTACAGAGTCTGCGCACCAACCTT
CATCGCGAGAAGACAGAAAAGCTTGAGCTCCGGCGCCTGCTGCAAGAGACTCGGGATGACCTGGAACGTGTCCGCGCCGA
TCCTAACACGGCTGCGGCTGCGGCTGCAGCTGCGGCAATCAAGAAGAACCGGAAAGACGTGCGCGAGAACCAGAAGCAGT
TGCGGCCTAGCCAGCTGGGCGGTCCCCGTTCAAGCCGTACAGAACTCTTCATCATTGCTTCGAACGACCCTGACTGGGAA
GAGATCGAGAGCGAACCGTCTCCGTCTGGCTCCGCAGCCAGGGCACGGAGACGGGGCACGGAAACCAGCGACCAGTTCGA
TACGGCAAACGAGGGTGTTGTTAGCGACGCGTCATTTGCGACTGCCAATGAAGGAGCCGAGACGACCACCGACGCTTTCC
ATACCGGCGCAGAGGACCTTTCCAGCGACGAGGAGACTATGACGGAGACAGACCAACGTCCTCGTGGCCGAGCACTGTCT
TCGAGAGGGAGCGGATCCGTATCTACGGCAAGAGGACCCCCAGCTCAGGATCCCGACGCAGCCAATCAAAGCACCGCCTC
AACCTCTGATGATGAATTCAAGTCGCCTAGGACGCCAACTGCCTCGACATCTGGTAGCACGTCGCACATGCGGACGCGCT
CCAGCCGCAGCACGCTAGCTTCGCACCGCATACGTCGTATGGCTAGCATCGAGGACCCCGGCAGTAGCCCTGCTGGTCTT
CAGGCCAGTCCGTTCAGTGCTACTGGGTCTCCTGGTGTCGGCCTGGGCCTGAACTCAATTAACAGCACGCCACGGGTTAT
CGGTCTGCAACAGAGCCTGTTTGCCGAGCTGGAGGAGCTGAACGAGAACAGCGATGAAGACATGGCCAGCGAAGGGACAC
CGATTCGCTTCCGCAGCCCACGGTCTCTGACGCCATCTGCAATTGCCAGGACCAGGAGCACCAGCAATCTGTTCCGCGGT
CGGTCTCCGCTGGCCCAAGTTCTGTCTACTTCAAAGGTCGTTATGGTAGACCGGGCTACTCTCACGGATTCCGTCACGAT
TTTGCCCTGGTCTGAGGAGGAAGAGAGACAGGAACAGCTGGGCGGCCTGGCACCTGAATCGCGGCCGACCTCTTTCCTGT
CTGACATCAGCATGGGCGAGCGGCTGAAAGAGTTCCCCTCACCTCCATTGACGTCCGTACGCGGTCTCGCCCTGTCTCCT
ATTATTCTTTCGCCGCCACCATCGAAGCCAATCGAAGTCGGCCAGAAGACGGAGGATGACAGTGGAGAGCTTCAGGCTGT
CGGGGAACCACCTCTGGAGCTGGCGATGTCTGTCATTGTTTCGGTTCCAATTGAGCCAGTGGCAGAGCCAGTGATTCCTC
CGTCCCCCATCATCCTCGCCCTGTCCTCTGTTCTGGCAGAACATGTTGTGCCCCTCAGTCCATCAGAGCCGGAGCCCCCT
GTCTTCACCTCATCAGCTCTTCATGCTGTTAATGTCAGTCCTATCGAGACGGAAGTTCCCGAACCGCCTACATTTTCACT
GTCGGTTGTGCTGGTGGAGCAGGTTGAGCCCATCTCGGAGCCCGAGCCGGAGGAAGCTGTGCCAGTTCCCATGGAACCGT
TTTCATTCACAGCTATGCAGTCGCAGTATGTGGAGCCGATCGCTGAGCCAGAGCCAGCGCCACCAGTCTGGGAACCATTC
TCCGTCTCAACCGTTCAGTCACAGTACGTCGAGCCGATTGCAGAGCCAGAGAAAGCTTTGCCGCCGGTGGAGCCGTTTGC
AGTTTCGGGGTTGTTGTCACAGCACATTGAGCCAGTCTCTGAGCCGGAGCGAGCCCTGCCCCCTCTGGAGCCATTCTCGT
TCTCGGCGGTCCAGGTGCAGCACGTTCAGCCAGTGTCTGAGCCTGAGCCAGTGCGAGCACTGCCTGTTCCAGAGCCGTTC
TCTTTCTCCGATGTGCAGACGCAGCAAGTCGAGCCGATTTCAGAGCCAGAAAAGGCTCTGCCTATTGCGGAGCCGTTCTC
GGTTTCCGGAGTCTTGTCGCAGCACGTCGAGCCAATCTCCGAACCAGAGCGCGAGGTGGTTCCGTTGGAACCATTTTCTT
ACACAGGTGTGCAGTCGCAGGAAATCCAGCCTGTATCCGAACCAGAACCACCAGTCCTGCCGCCACCGTCACTTTCCGTG
TCTGCGGTGCAAGTCGAAGATGTCGAACCGGTGTCTGTCCCCGAAGAGCCGCTTCCAAAAATGGCCGTGTCCGGCGTCTT
CTCTCAGGACGTCGAGCCTGATGTCATTGCGGAAAGCGAGGATGAGAAGAAAGATCTGGTGGCTGTGGCTGCTCCTCTGG
TGTCTGTCAACTCCATTGGAACGCAGACGGACGAATGGAAGCCTGTGCTTCTTCCTGGGGCTATCGCTACTCTCGGTGCT
GCGGCAGTGGCTGGCGGCGTATTTACTGGCCACGAAGTCGGCTCTGTGATCTCTGACGGACAGCGGAGCCCTAAGAGGAA
CGCTTTCATCATACCCCGCGATGGCGACGAGCTTTCGACCGCGACGAGTTCGCCGGAATCTCGCCAGGCGCCAACAACGC
CGAGCAAGTCTGCTCGTGGTCCCCTTATTGGGGGTTGGTCTAAGCACACTGGTCCTCCCACTCCAGTTATCGCAGAAGAC
GAGACGCAGCAGTCGCCGAGCACTGATTATCTGTCGGAGACGCCAGAGTCTGACCGTGTTTTCAAGGAGATTTCAGCCAA
CGCGAACTCTGGGAATGTCGTGCGCAGTATCGCCGCCGAGGAGCCTGTCCGTTCTCTGGAGGCCATTGGTGCTACGCCAT
ATGTTGGCAGCAAACCGGCGAAGCAGTCTTTTGCTGTCGGCGCGATGGGGCAGAATGTCCTGGAAGATGGCACGGGCAGT
TCTATCAAACGCGGCAAGGCTATCGATGCAACTGGTAGTGCGGCTCTGCATCGGCCTGGCTCTGCAACGAGCAACCGGCT
CTCGACGGACTTTTTGCCCCCGCTACCAGCCAACCACAGAGAGGTGATCGAGGCTGCCCGGAGCGGTTCTGCCGGCTCTA
TGGGAAGCAGCGGGCCTGCTGCTGTCGCCGCGCCTGGTGGCATGGCAACATGGCGGGCACAGACGCCGACAGGAGCAGCT
GCACGGGAGTTCCATTATGCGCACTATACCGGGACACCGACTCCGAAGGCCAACGTTCGCAACGGTGCGGCCGGCGTGGG
CGAGCTGCACGCGCCGTCGCGGCCTTCGTCTCGTATGAACGCAAGCAACGCCGGTGGAAGTGTTGTACCAGGGGCGATGG
GCTCGCTCAGCCGGCAGACATCCGTGTCGTCGTTCGCGTCGGAAGTCAATGCTCGGTTCAACATACACGACGGTGACGTC
TTCGGAAGTGGGGCTTCTAGTCACATTGACCCGCGCATGATCCAGGCTATCACCCAGACCATGATAGGCGAGTATCTGTG
GAAGTACACGCGTAAGACTGGGCGCTCGGGCATGTCTGAGAAACGGCATCGTCGGTACTTTTGGATCCACCCCTACACGC
GGATGCTCTACTGGAGCGATCAGGGACCGTCTGCCGACAGCCGCGTGGAGCAACGGGCGAAGAGCGTCGTTATCGAGGGC
GTGCGCGTTGTGACAGACGACAACCCGATGCCTCCTGGCCTGCACCGGAAGAGCCTTGTGGTGATCTCACCCGGCCGCAC
GATCAAGTTCACGTGCAGCACTGGTCACGGCCACGAGGTCTGGTTCAACGCGCTGTCTTATCTGCTCCTGCGTAAGGAGG
AAGGGGCAGAGGACGAGGGCATGACGGCCAACGGGGAGCAGATCACGCGGGAGGACGTGGAGGAGTTCAACCCTGCGTTT
GGGCACCGTGCAGGCGCCAGCTCTGCCCAAGCCCGGCGTCAGCCGCCCGTGTCGCTGTCGTCGTATAACTCGCGGACGAC
GCACAACGAGTCACCTGCGTTTGGGATGACGATGAACGTGCCGACGTTGACGCCGACGCCGAAGAAGAACACGAATGGCC
GGGTAGGCTCCTCCATCACGCCGTCTCGGTCGGCAGCAAGGATCGCGTCGCGAAATCGCCTGAGCCGTATTGGCGGTTAC
TGGCGATCGAGCCAAAATCGCTCTCCACGCAGTTTAGCATACGCAGCCACCGGCAGAGCAACAACGTGCCGCAAGAAAGC
GGGATATACGAGGCCAGCGAGGTCAACGACAGCGCCGAAGATGCTCGTGCTCTCTTTGTGGCCCAGGACCGGGAAGCTGG
CCGGCTCGAGAACGTGCGGGCCTGTTGTGATGGTGAGTCGACTCGAGATGCTCTCTCGGACCGCAGACAGCAAGAATGTG
ACTGACATGGCACAGGCAAACACGACGTCGGCACGCTGTCGCATAGCACGCGTCGCAACCGACACTCGCAGCAGCCCACA
TCGACGATGTCAACGCCCACTCATAGTACCGTCCGTCACCGGCCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62