GenePrediction:GLEAN_5423 Details

Name: GLEAN_5423
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:753941..753190 (- strand)
Length: 752
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:753941..753877 (- strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_132:753753..753655 (- strand)
Length: 99
Type: CDS
Source: GLEAN
Position: GCSC_132:753601..753190 (- strand)
Length: 412
>GLEAN_5423 class=GenePrediction position=GCSC_132:753941..753190 (- strand)
ATGGCTCCCCTGTCGTACTCCAAGACCGCCAAGGTCCCCCGTCGCCCGTTTGAGGCCGCCCGACTGTTCGTGTCTTCCCC
TGCCATCCTCACCGGCCACTGAGCAGGAGCGTGTCTCTTGCCCATGTCGTTGTGAGCAATCAGCTAATGGAGGGTTGTGG
GTTTTTCTCCTCTTCCCCTGGACTACAGTGACTCCGAGTTGAAGCTTGTCGGCGAGTATGGTCTGCGCAACAAGCGCGAG
GTGTGGCGTGTCATGCTGACGCTGTCCAAGATCCGTCGTGCGGCCCGGTGAGTGGTCCTGGATTGGTTGGGCTGGGAGTG
CAGGGTGCTAACAGATGCAGTCAACTCCTGACGCTCGACGAGAAGGACCCCAAGCGGCTGTTCGAGGGCAACGCCCTGAT
TCGCCGTCTGGTGCGTGTCGGTGTGCTCGACGACTCGCGCATGAAGCTCGATTACGTGCTGGCCCTGAAGGTCGAGGACT
TCTTGGAGCGTCGTCTGCAGACGCTGGTCTACAAGCTGGGTCTGGCCAAGTCGATTCACCACGCGCGCGTGCTCATCCGC
CAGCGCCACATCCGCGTCGGCAAGCAGGTCGTCAACGTGCCGTCTTTCATCGTCCGTCTCGACTCGCAGAAGCACATTGA
CTTCTCGCTCAACTCGCCCTTTGGCGGCGGCCGTCCTGGCCGCGTCCGGAGAAAGAAGGCCGCGGCCGCCAGCAAGGGCG
ACGGCGAGGAGGAGGAGGAGGAGGAGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62