GenePrediction:GLEAN_5425 Details

Name: GLEAN_5425
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:749994..747956 (- strand)
Length: 2039
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:749994..749952 (- strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_132:749852..749716 (- strand)
Length: 137
Type: CDS
Source: GLEAN
Position: GCSC_132:749558..749184 (- strand)
Length: 375
Type: CDS
Source: GLEAN
Position: GCSC_132:749134..747956 (- strand)
Length: 1179
>GLEAN_5425 class=GenePrediction position=GCSC_132:749994..747956 (- strand)
ATGAAGACCTTTCGCAATGTGCTGGGCAAGAAGAACAAAGATCGTGAGCTGTCTCCGGCCCCCCCAATTCGCCCCGCACG
TGTCCGGCGTATGCGGCCGCGATCGGTGCCTTGCGAGCAGTCCAGCTGACAAGCCGTGCCAGAACTAGCTCCGAATGACG
GCACGCCGCCCGCAGGACGGGCCTCTATTTCCGGCACGGTCGGATCCGAGCGCGATACGTCCAGCAATAGCCTGGCCGAC
GATGCAGAGACGCCCGAGGCTTCGGCTGCCCGCTTGGTGGTAGGCAGGACGAGCGAGGACGAGCGAGAGCGATTGGAGGA
CCGTGGCTGACAAGGACCGTGGCAGAAAACGTTCTGCCTGAGCGAGACTGACGGATCGGTAGGCTGTCCGGACCTGCTTA
TCCATGTCCACATTCACGCTGACGGCCATGTTCCAGGGAGCCGAAGAGGCCATGCTGCCCAGCCTCGTCGAGGCGGCCGA
GTCGTCACCCGCGGCAGCAGCCGAGTGTGCTCGCCACATCCGCAAGTTCCTGTACCGCGAAAACTGGCGCCGGCCCACCG
TCATGTACAACGCCATCATGCTGATGCGCATCCTGGTCGAGAACCCGGGCCACACGTTCACGCGCAACATGGACAAGAAG
TTTGTCGAGGCCGTCCGCGAGGTCCTGCGCAACTGCCAAAACCTGCAGACGGTCCAGTCCCTCATCGACGCGCTGCAGAG
CTTCGAGGCCAAGAGCGTCGTGGACGAAGGCCTGGGCCGCATCGTCGAGATGTGGCAGAAGGAGAGGGCCAAGAGCAAGA
TCCCATATCCGGTGCGTACGACTCCTCATCTCTGGCCCTCCTCGCTTCTGACAGCCCTAGGCCCATCCGAACGGCCAGCC
ACAGTTCATGTCACCGATGCAGCCGATGCAGCCGATGCAATCGATGCAACCGATGCAGCCGATACAGTCAATGCAGCCGA
TGCAGCCAATGCAGCCAATGCAGCCGTATCCGGTGTACCAACCCTACACCATGGGCCACCAGCCGAGCAACAGCCAGTAT
GAATGGCCGTCTTATGGTGGAAGTGGAGGCGGAGGCGTGAGAAGCAGCGGTGGTGGCGGCCACCACAGCAGTCGCTCGCT
GCCACGACCACAGGAGGTGCGAAAGCGTCTAGAGGAGGCACGCACGACAGCCGGGGTTCTGGCCGATGTTGTCAACACGA
GCTCGCCACCCGCCCTGCTAGACCACGATCTGGCCGGCGAGCTGTCATCCCGATGCCGGCGAGCGACAGCTCAGATTCTC
GACTATCTCGACGCGCAGAACCCGATCCCGGACAACACGGAGATGGCACACCTGCTGACGGTGCACGAAGCCGTGCAGCA
GTCGCTGCACCACTACTACAGAGCCGTGCTGGAGGCCCGCAAACAGCTAGGCATGGGCGAGACGCGGCGCAGTGAGACGG
GTGGCGTGCCAGCCATCGAGATGACACCGGCCGGCCAGAGCAAAGACAAGGGCAAGGGCACGGCAACGAGTCCGGGCATA
GCGGACGGACCCGGCGGAAGCACCAGCAGCGGCGACGCTTACGTCTACGGCGGTAACGATAGAGGAAAGGCCAACAGCAG
CAACGGGGGCCTCGTAGGTGACAGCAATCCTCGGTATTCCGTGACCGATCTGTACTCGGACTCGGACTCGGACTCGGACG
GCCGGATGGCAGCAGCCATTGCCGCCAGCACGGCGCCCGGAGCCAACAGCCGGCCGTCACAGCGCTACCTCAACACGGAC
AGCCCGTTTACAGACGCGCCGGCCGAGTCGTCCCGCTCGTCATCGCGCGTGCGTCCGGGAGCAGGCGGCAATGGCAAGGC
ACGGCAAAAAGGCCCAGCTACGGGCTCGTCCGCTGCCTATGCTTTGGATGGCGTGTCGCCCAACGAGCCAGAAGACTACC
AGCCAGCAGGCGGCAGAAGTGGTAGTGGTAGTGGTGGTACTGGTGCTGGTGCTGGTGCCTCCTCGTCGTCTGCCATCGAC
TCGGCCGCACATGCAGGCGGGCCGGTGTATCGCTACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62