GenePrediction:GLEAN_5426 Details

Name: GLEAN_5426
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:743821..740848 (- strand)
Length: 2974
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:743821..743426 (- strand)
Length: 396
Type: CDS
Source: GLEAN
Position: GCSC_132:743340..743078 (- strand)
Length: 263
Type: CDS
Source: GLEAN
Position: GCSC_132:742909..740848 (- strand)
Length: 2062
>GLEAN_5426 class=GenePrediction position=GCSC_132:743821..740848 (- strand)
ATGGTAATGGTCTTAGCGCCCTCTCCCGTCTCGCCGCAGCCTGGCCACGCCTCGTTGGGCAGCACATCGTCCGTCTCGTC
GCACGACGGCAGCGATGCCAGCGGTGGTGACAACACAGACGGCAATCCTGTCCCTGCAGAGAACCGCACTGTCGTCACGC
TGTTTGCACCGGACCTGGAATACATACTGCGCGCCCACAACTCATTACGGGGCCTTTGCAAGAATCCTGGCCGGCTGGAG
CCGAATTTTGCAAAGCGCCCGCTGCCGAATCCACGCCCGATTTGGTTGGCGGAACTCAGCGACGTCCCACTAACAGCCAG
ACTTCTGATATTGCCTCCGCTGAGCAACTACACGGAGGGATATTCTCTTCGGACGCTGCTGTGCGACCTCGGAAAGGTGA
AAAGACCCCAGTCTTCAAGACGTTTTCGCTTATAAGACACAGCCTGGCCCTGGCCTTTCCAACTAACATGTCTTGTCTCA
GAGACGGCTTGGTATCTTGGATGCCCCATCTGCAGACCTTGCCTGCAAGCTGTACCAGCCAGACAGGTTGTCATTCACGG
AGGAGGCGCTTGAAAACGTGGTGCTGACACCGGACATGGTGGGTCTGGCAGCTCGATTCACCGAAAACGACGCCAACAAC
AGCTTGATTAATAACATGCATGTTGCCGGCGGTGATGACACAGGCGACGGCAATGACGACGAAAACCAGGCCGTGCCAAC
CAACAATTCGTCGTTGCAATCGTTGTACGTTTTGCAGCGCTGGGGCAAGCATGTGCGGGTGATCAGGCAGCCAGATGAGC
TGGACGTGGCGCGATATGTGTCTAACATGCCACGTCTGAAAAGCATCAGGCAAGCATACAAACATTCTCTCTCCCGGGTT
CTCCCCTCGCACACACACTAACAGACGTGCAGCTGGGAGTATCCGCCGAACGGTGACCGAACGGCAGGCTTCCAACGCGT
CATTAGCAATGGGGTCATCTCGTACGGAATAGGGGGGCTACAGGGCATTGCATTGGGACATATGCTCGGGCCGTCTGTGC
GGCTGTGTCTCGACGGCATGCCACTGGAGGGGATGGCCCGGCGGCTGTCCCAGTTGGTGAGTGGTGGCGTGGACGCAGAC
CGTGAGCTTCGGGTAGCACTGGGCGGGCTTACTTCGATCCGGCTGACAGTCGGAGGCCCGGGAAACGAAGTGGTGACGGC
CGCAGACATGGACGCACTGAAACGACTGCTGCTGCTGGCGTCACCAAACCTGGAGACTCTGATTGTGCGGGCGACCGTGG
AAGCGGAGCACGACGGATACGCAGGTGCAGACAGAGGAGACAGAAGAGAAACAGGGGAAGCGGAACAGGGCCGCTTCTAT
CTGCCGGCCTTTTCCTTCCTGCCTGGCGAGCGGCTCCCGCCACTGCGGTACCTACACCTGTGGCGCTACGACTGGCGGCG
ACACTCATCGGCAGACGTGGCAGCCCACTGGGACTTCTCGCAGCTGCGCACACTTCTGTATGACGGTGCGCCACTGCGCT
GGTTTCTCGGCACGCTCTCGTTTGCATGTCTGGCAGGCTTGCAGACGCTGCGACTGGACGATGCCGAATGGGCGCTGCAG
CCAGGCCAAGGCAGACAGGCAGCGCTGCTCGTTGGCTACCTGCTACAGCACCACATCAAGGAGCTGCGGCAGCTAGAGCT
GGTGCGCTGCTACACGGACAACCTGCCGATGGCGGCGCTGCGGCGACACGTCGGCACACTGGAGGCGCTCGTTCTGCGGC
ATCCGTATGGGGTTGGGGGAGGGAGCACGGGCGACGCTGCAGGAGCCGAGCTGTCGGACGCGGCGGCAGCCAACATCACG
CCGCTCAGTCTGCATGCGCTATTCGAAGAGGGCAGCAATGAGGAGGTCGGCTCGGATGGGATGTACGTGGAGATGACGGT
GGAGACGCGTCGGGCGCTGCTGCTGAAGCGGCGGGGAAACCCAGTGTTTTCGCGGCTGAAGAGGCTCGAGATCGACATGG
ATGATCGCCATGTGGCTGCTGGAACGACCGGGCAAGGCACCGGAAATGCAGGTGGTCCGCCCGAGGGCATCGAAGCAGAG
ACGCTTTCACGACTGGCACGACTGCCGCGACTGGAGTCGCTGACGCTGGCAATGCCGTCAGCCCTGCGAGGGCTTCACTG
TGTGCCCCGTTACGACGTGGATCTGCACCAAACGCTGCAGCGACTGGTCTATCTGCTGGGACAGCGCGAGGAGTTAAAGA
GGAGGCATAATGTCGAGGCCGAATGGCTACAGGACTACGAGAAGAGGTGCCATGACGGCCGGCAACAACAACAACAGCAA
CAGCTGCCTGAGATGGCTTCCCTCAACCGAATTGCTGTGCACATCGGTGGCTGGATGCCACCGCGAGGAACTGGCATCGA
CGAGACCGGCATGACTGTCACGCACTGGTTTCCGCCGACGGCGGCAAGACCGGTAGAGCCAACGATGCTGACGGCGGCGA
ACGGAGCGGGTGCGTGGGCAGCCCCGACGTTTCTGGCGCCGTCGCGCGATGTCGACGTCAGTCCAGGCGTGGGAGCGGCA
CTGGCTCTGCGAGCGATCGGACTGCGGTCACAGCGCTGTCTGGTGGCAGAGCGGAGCCTTGACGAGGACTGCGAGGATTG
CGAGGACGAGAAAGGCGACCAAGGGGAGAAAAGGGAAAAGGGAAAGGGAAAGGAAAAAGCCAGGGATGGTCGGAGCAATG
CCGACGAGGGTGGTTCTGGCAGTGGCAGCGGAACTGCCAACACTAAAATCGGCTCTCCTGCTCATTACACGATCAGCGAA
GAGTACAGCGATTTGGTCGAGTACGTCGAAGACCGGCCGAAAGAGCTATCCTGGGTGCCGGGTCAGGCGCGCCATGTTCG
TGTGCGACAGCCGTATGAGATTCGGTTCGCGAGACCGAGGCATTTGGCAGAAGGGCCATTGTGGGATGTCAACGGACTAG
CCATGTGGCCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62