GenePrediction:GLEAN_5428 Details

Name: GLEAN_5428
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:717428..715101 (- strand)
Length: 2328
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:717428..716143 (- strand)
Length: 1286
Type: CDS
Source: GLEAN
Position: GCSC_132:715512..715101 (- strand)
Length: 412
>GLEAN_5428 class=GenePrediction position=GCSC_132:717428..715101 (- strand)
ATGTCTGATACAGACTTGTCCTCCAACCATCTCGGCATTCAGCCGGCAGGCCCGTCGACTTTTCATCGATTCATAGGCCT
GCCCCCTGAGCTGAGGGTCACGATCTGGCTCCTGGCCACACCTCGTCAGACCCGCTTCATCCTCTTGGACCCAGGTGTGT
GTCAGCCTGCCGAAAAGGTGCCGGATGACAATACAGGCTCTGCAGAGCAGTTTCAGAAAACAACACGCGTGCATGGCCAG
TTTCTTGGCCCCGTCACTTGCTTCGTCCCGCCATCTTTGGCATACGACATTGTCTCTGACGAGGAGGGAGCAGGCCGCGT
CTTCAGCACTTGGTCAGTCTTCCCCAAGGACCAGCGGCTTCCAAGTACGCTTTATGTCTGCCACGAGTCTCTGGACTTCT
TGACTACGTACTGTGGCAAGAACTGCTCGAGTCCTCGCTACACGCGGATGCCACGTTACCTGCGTACCCCCACATGGCCG
CACTTCATTGTCGAGATGCGCTGCCCTTTCATTTCCTACGAAGACGACATCTTTGTGAAGGGCAGACACGAACCGAAGTT
CTACCCATTCCAGAGGTATCATCTTCCTTCGTTCTGGCCTCCCATGATGATTGATGAAGCTGTTGTATCTGCGAGAAAGG
CTCAAGAGATATCAAAAACGCGATCTGGTGTCTCGTATGAAGCAGTTGGGATTGATTTTTCATCTCGTCATCATTCAAGC
TTCAATATCGATAACTACGGAAGGTCCTCTGGCTGCATCCATGTCCCAAAATGGTCTCTGAAAAAAAATGAGGCCTTCTC
CGTCTTTGAAACCCATCTGATCCGGCGCATTGGAATTACAATGCGCAACTGGGTATACCGAAACATGAATGTCCACCGCA
ACGGCGGCAGATTTGACACTTTTCCTGGGCTGAAGGAGGTTGCAGTCTTTGGAGATCACCCTGTGCTCACCGATGTGAAC
CACAAGGTAACCTCAGAATTTGATGGCGAAAAGATCAGATGGGACGATGCCGAAGTTCGGGGAATGATTGAAGCGCACAA
ATCTCACCTGGCCGTGAATCACTTTGCGGAACAATTTTTGCAGTTCGACGACGAGCCCGAGGAGGAGCCTCATGAGCAGC
CCCAAGAGGAGCCCGAAGATGACGATCTTGAGTCGGTCCACGAACCGACGGAAGACGAGCGACAAAACGTCCTCACTGAC
CGTCTGAATGGTGAGTTGTACGTTGGTCTTTCCACCAGCCCATACAAGGCATCCGGCTCTCGTCGGTACCTCGGCATGGA
GCTGTGGTAAACGCCAAGCCCACAGACAACAAGGTAAGCTTCGTGAGAATCCGAAATCGCTGTCCATTGCTAACGATACC
AGGATGCAAGGCAATGGAAGAATGTATGATTATTTTCTGCTTCAAACCCGATTTGCTTTATGTTGTAATTCAAGAGGGCC
TGACCAGCCTCACCAACTTTGCTGCAGATGATTCTAGATAATTCCACAAGAGATCGCCGATACAACTTGTAACGCAGGCT
TCTCTCACTTAGCTCTAGTTATTTTGCGAAGGATACAAAAACATCAATTTCCACGAGGATGCCATGTCACAGTGCAAGAT
ACCGATTGTGCCTCAATATTTATTGAACCCAACATGAAAACCCTTCTGTGCCATGACTCTATCACCTCCGATCCGAACTG
TGATGATGGGGGTAGCTGAACTTTGTCAGTGATTAAAAGGCTGAAAGCCTGGTGCTCCGAAGTTAAAAGAGAGCAACCAT
CAACAATTACTTGGTCACGAACAAAGGCTGTACAAAACATCAAATTATGATTCTACTATGCTTTTCTTCTCCTGATTTTC
CCGACGCTTATGCCGATTACATGGCAATGATTGCAAGTAAGGCGCCTAAGAAAGCCGTCACAGAACCGATTTCAAGCCGG
GCGTTTGCACCAGCTGTGACCACCGTAGATGAAGCGCTGCCACCAGAGGCAGATGTGGTACTTCCCGACTCCGAACCGAA
ATCAGAACCTTTCGCGGAACTGGAGCTCGTGCTTGAACCTTCAGTTCTACCACCGCTTTCACTGTCAAATTTGGCCTCAG
AACCTGATGTCGACCCTGACCCTGACCCTGATTCCGACTTGGAGCTAGATGCTGAGCTAGGCTCGGAGCCGGAACTAGAA
GATCCAACGTCTGTGCTACCACTGGCACTGCTGGTGGTGGTAGTATTGTCCTCAACTGGCTTCCAAGAGCCGCTGTTGCT
GCCGCTACCGCCTGTTCTGTCTGTTCCACCCGTGTTGGGAACGCTTGCATCGCCAGGTGAACCAGGATATCCACTGGGGC
TACTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62