GenePrediction:GLEAN_5431 Details

Name: GLEAN_5431
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:701780..700602 (- strand)
Length: 1179
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:701780..701692 (- strand)
Length: 89
Type: CDS
Source: GLEAN
Position: GCSC_132:701550..701196 (- strand)
Length: 355
Type: CDS
Source: GLEAN
Position: GCSC_132:700946..700602 (- strand)
Length: 345
>GLEAN_5431 class=GenePrediction position=GCSC_132:701780..700602 (- strand)
ATGGAAGAGACCAGCGCAAAGACGTGGCTTGTGATGCCGTTGTACATCTACCCACTCACCGAATCCACATGGGGCGCACT
CTATGACGTGTATGTGTCACCTAGCCGTCGTTTTGTCCCTTTCTGACTATGACCTCTTGGCTTTTTTTATGCCTCTCCGT
GTCTCTGCTTGCTTCCGTTGTCTCCGTCGTCTCGTCTGAAGCTGATCCTGCCCCCCCCACCTGTCTGCAGGATTATTGGG
TATCCAGACCTGAATTTTCTGGTTATTGTGAACCCAAACAGTGGCCCAGGCGACGCCGATCTGCCTGGCCACGACTATGT
TCGAGAGGTGCCGAAGCTGAACTCGTATCCAAACGTGTGCACTGTCGGTTATGTGCGCGTGGGCTGGTGCAGGCGGACCC
TCGAGGAGACGTTTGAGGATATACGGACTTATGCCGACTGGAAGCGGGACGACATACCGGGTTTCTACGTGGAGGGCATC
TACCTGGACGAAACGCCGAACCATGTCGCGCCGGAGCGGGCGCAGCACCTGCACGCTCTCAGACAGTACATCAAGAACGC
CGAGGGACTAGTGGGCGACCGTCTGGTATGTGATCATCCCATCTTGTTGGAAGGAAGACGTGCATGGCCGCTCGAGCGTA
CGCCGTATTCGCAGTGGTTGGGAGCCAATCGATCCGCTGGCAACCGCCGTGGCGCTGTTTCTCCTCTTCCTTCTTCGTGT
TTTCTCGGGGTTTTCCTTTTTCGGCTTTGGCGCCGTTCTAGTGCCGTGGTCTATTCCCGGTTTCGAAACTTATTAATAGC
TAGTGAAGCGCTGATGCTGATGTTGTGTGAGCAGGTCGTGCACAATCCAGGAACACCCCCGGAGGGCCACCTGAAGCACT
TTGGAAGTCCCGACATGGTGTGCTTGTGCGAGGAGCCCTATAAGATGTACGGTGACGACGGCGTGCAACGGCGGCTGAGA
GACTACGCCCTGCCTTGGCACCAGACTATCTATCAGATTTCGGGCATCCCGGCCGAGCTCATGGACGACGTAGTGCAGGA
GCTGTGTCAGCGTGCCAAGTATGTGTTTGCAACCGACCTGGTCGACGACTTTTACGAGAGTTTTAGTCCCAGCTGGGCAG
GATTTGCGGCGGCGGTGAACCGGAGCAACCAGCTGCAGGCCAGAGCGGCGTGCAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62