GenePrediction:GLEAN_5433 Details

Name: GLEAN_5433
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:687050..683813 (- strand)
Length: 3238
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:687050..686801 (- strand)
Length: 250
Type: CDS
Source: GLEAN
Position: GCSC_132:686721..686665 (- strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_132:686598..686522 (- strand)
Length: 77
Type: CDS
Source: GLEAN
Position: GCSC_132:686448..686273 (- strand)
Length: 176
Type: CDS
Source: GLEAN
Position: GCSC_132:686217..686101 (- strand)
Length: 117
Type: CDS
Source: GLEAN
Position: GCSC_132:686016..685734 (- strand)
Length: 283
Type: CDS
Source: GLEAN
Position: GCSC_132:685672..685581 (- strand)
Length: 92
Type: CDS
Source: GLEAN
Position: GCSC_132:685435..684974 (- strand)
Length: 462
Type: CDS
Source: GLEAN
Position: GCSC_132:684919..684775 (- strand)
Length: 145
Type: CDS
Source: GLEAN
Position: GCSC_132:684717..684645 (- strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_132:684581..684400 (- strand)
Length: 182
Type: CDS
Source: GLEAN
Position: GCSC_132:684339..684222 (- strand)
Length: 118
Type: CDS
Source: GLEAN
Position: GCSC_132:684161..684075 (- strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_132:684006..683813 (- strand)
Length: 194
>GLEAN_5433 class=GenePrediction position=GCSC_132:687050..683813 (- strand)
ATGGCCATCCTATCGAGTGTCGAGCCCATTGCGCTGGACGCCATAGATGGCAAAGCCCTGCACGAGAAGACCACGTCCGC
GTCGACGCCCTCGGACGGGTCGGAGAAGATACGGGCCTTTGACGACGACGAAGAAGAGGTGCACGTGACCAATCCGGAAC
AGCGCCGGATCTTGCAGGAGCTGGCCGACAAGGAGGAGCTGATCCCGACGGAAGCGTTCAAGGCCAATGTCGACGGCGAC
CAGTCCCCGTGTAGGTGAAGAAAGAAAGACGCAGCCGGTTAGCTCTATTGCGCATCACTGCTGACTCGTTGTATCTTGTC
CTCTTGCAGTCCCCGAGGTCGCGGCATGTGTGCCGAATACAGACGACCCAACAATTCCCTGCAATAGTGAGCTCTGTTTT
CTTGATCTCATTGTACCAGACAGCTTGGGGTACTGACCGTGCTGCCCGCAAGCTTTTCGAGCTTGGGTTCTGACCACATT
TTGGGTGCTTATCTTGGCCGGTGTCAACCAGTTCTTCAGCATGCGCTATGTACGAAGAATGTCCTTGTATCTTATTCGTC
TCTATTTTTTTCTGCCGTGACGACGCTGATAATATTGTACAGCCGTCTCTCGCGATCAGCTATGTTGTCGCCCAGATTCT
AGTCTTCCCCATGGGCCGTTTGTGGGAACGCATGCCGCGCTGGCGTGTGCCTCTCGGCAAATATTCCTTTGACGTCAACC
CCGGGCGCTTTTCGATCAAAGAGCACGCTCTGATTGCTATTGTCCGTGGAGATGTCCCGTCCTCCTGTCAGGGAAGTGGA
CAACGAGCTAACTTAGAAGTGTTGTAACATTAGCGTTTCGACGGCCTACGCCTCGGGCTCACTCGTGGCTATCATCAGCG
ATGAGTATTGGGGCTTAGACTACGGGGCTGGCTTTTCCTTCTTGTATCTTCTCACTTCTCAGTCACTTGGGTATGCTCTT
TCCTTTTTCTTTCTTGTCTTCTCCACGGCGTACGTCACGTTTCTATCCCAGCTCACCGCTGACTGTCAAAATAGGTTCGG
ACTTGCAGGACTTGCACGCCGCTGGCTCGTTTATCCGGCTGCCCTTATCTGGCCGGCGTCCCTACCATCAGCCGTTCTCT
TTCGCGCTCTGCACGAGCCGCAGGACAGGTCGGCTGTCAATGGATGGACCGTAGGGCGGTACCGGTTTTTCAGCTACTTC
TCCGCTTTCAGCTTCGTTCTGTACTGGATTCCAGATTATATATGGACAAGCACAAGCGCCTTTGACTTTATCACCTGGAT
TGCGCCGCACAACCAGAAAGTCAATACCATATTTGGGGTAAGATCTCCACGTCTAAATGGAAACGCATTGCAACAGGAGG
ATTAGCTGACAAAACTAGATGAATTCTGGTCTTGGCCTCTTGCCCTTGAGTATAGACTGGACCCAAATCACGTACGCGGG
ACAGCCGCTTCAAACACCCTTTTACATCACGTGCAATGCATTTGCTGTTGTCGTACTTTTTTATCTTTTCTTGTCACCTA
TTCTTTACTACACAAACGTGTGGAACAGCGCATAGTAAGATATCTCGCATCGTTCTATATACACGAGTTCGCCACTGACG
TATCCTGCCATCTAGTCTGCCGCTACTCTCCTCTTCGACTTTTGATAACACGGGAAAAGCATACAATATTACGCGTGTTA
TTAATTCCGACCTTACATTGAACGTTACCAAATACGAAGCGTACTCGCCCATGTACATCACCATGTCCTATTCGCTCTCA
TACGCACTTTCATTTGCCGCCGTGACGGCCATTGTCGTCCATACGTACCTCTACAATGGCTCGGAAATCTGGGAGAAATG
GAAGAACGCCAAGAGTGGCGGAGAAGATGTTCACAGACGCCTTATGTACGCTTACAAGGAGGTTCCGGACTGGTGGTATG
GCGTTCTCACGATCGTTGTTTTCGGGCTCGGCATCATGACTATTCGTTACTGGGACACGGGCCTTCCGGTATGGGGCTTC
ATTGTCGTTTGTGGAGGCTTTGGTTTCTTCCTTATCGTGCCAGAAGGAATTTTGGAGGGGACAACGAACCAACGGATGTA
AGCATTTCCCCCAAAGCAATCACAGGTAACCGCTACTCACAACAATCACAGCTTCCTAAACATCATCACCGAGCTTGTCG
CTGGATATGCGTGGCCAGGAAAGCCGATTGCCAATATGATGGTCAAGTGCTTTGGGTACAACTCGGTCAAACACGGCATG
GATTTTGCCCAGGATCTCAAGCTTGGACAATACATGGTATGTCTCCTACCTGTGATGCCTCAGAAAATTCCTTTTTGTGC
TGACGGCACTTAGAAAATCCCTCCTCGACCTCTTTTCTTCGGCCAGATCTACGCCACTATCTTAGCTACGATGGCACAGA
CAGGTGGTAGGTTTCTTTCTGCATCCATGATGTCAAATTTACAAACCATCGTTTAACAGAAATTTATAGTTCTGCGCTGG
ATGATCGGCCACATCCCTAATCTTTGCTCTCCAAAGAACACAGACCGGTTCACCTGTGCCGGTGCCAAAGTTGTGTACAG
TGCATCTATGATCTGGGGCAGCATTGGTCCACAACGCATGTTCCAACATGGGCAGGTGTATTCGTCCATCATGTACTTCT
TTATCATTGGTGTAAGTTCGAAATAAGAACTAGCAGAAAATTTGAGGCTAACAGAGTGCTTCTCTCTACAGCCAGCTGTT
ACCGTGATCGTGTACATTGCGTACAAGCGCCATCCACACAGCTGGATCAGATACATCAACGTGCCCATTTTCTTCAATGC
GGCGGGAAATATTCCGCCTGCGAATACGAGTGAGTAACCCCCTTTCTGAGATAAACTGCTGTTGTGCTCGTAGTGACACT
GAATGACAGCACAATACTCGCTGTGGTTCATCTTCGGCTTCATTTTCAACTACCTCATCCGAAAGCGGGCCTTCAACTGG
TGGCAGCGCTATAACTGTAAGAAACTGTTATTTTTTATTCTACTTCTGTCTTTGTCGTGATGAATGCTAAGCCATCCCCG
GTAGATCTTCTTCAAGCCGCAATGGACACAGGTACGGCCATCGCAACGATAATTATCTACTTTGCACTAGACTACCACCG
CACCACGTTCAATTGGTGGGGAAACACGGTGGGTTCCAACACAGATGACGCAAATTCAGTGCCGTGGTTGAAGGTTGCGA
AAGGCGGCCATTTCGGCAAGGGCCCTGGTCAGTTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62