GenePrediction:GLEAN_5435 Details

Name: GLEAN_5435
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:676090..672375 (- strand)
Length: 3716
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:676090..675995 (- strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_132:675916..675838 (- strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_132:675703..675058 (- strand)
Length: 646
Type: CDS
Source: GLEAN
Position: GCSC_132:674994..673101 (- strand)
Length: 1894
Type: CDS
Source: GLEAN
Position: GCSC_132:673043..673001 (- strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_132:672930..672640 (- strand)
Length: 291
Type: CDS
Source: GLEAN
Position: GCSC_132:672586..672375 (- strand)
Length: 212
>GLEAN_5435 class=GenePrediction position=GCSC_132:676090..672375 (- strand)
ATGGCCCTCGACTTTAATAACATCAAGAGTTGCATCGTTGCAACTCTTGATCCGGATGGCGCTGTCCGGCAGACGGCCGA
GGCCCAACTGAAAAGCGTGCGTGCCTCACTATTCCTCTGCCTCTCTGCTCCTCTTGTGCTGTCTGCAGGCCGCTGACCGT
GCCTCCTCATCTAGGCCGAGACCCTCAATGGATTTACCGATGTCCTCCTCACCATTCTCGAGACCGAGCACAGCCAAAAT
ATCAAGCTTTCTGGTACGCCCACTTTGCCTCTCTTTGTCCTCCAAGTCCTCGGTTGCCCTCTTTCTTTTCGTCTTCCTCT
GCTATCCTCTTTATCTCTTTCTTCGTCCTACAACTCTGTTTACTAATGCAATTCCTCGTCTCTACAGCCGCCATCTACGT
AAAGAACCGAGTGAACCGGGCATGGACGTTTGTGGATGTCTACCCCGACGAGCGGCTACTTACCGACGAGGAAAAGGCTC
AGGTGCGAGACCGGCTGCTACCCATTCTGGGCGCATCACCAGGCCTTGTCCGACAGCAACTGGTGCCCCTGCTACAACGC
ATCCTGCATTGGGACTACCCGGCACAATGGCCGACCTACATGGAATACACCATGCGGCTGCTTAGCACGAATGACATCCA
AGGCGTCGTGTCCGGCATCCAGTGTCTGCTCGCCGTCTGTCGCACATACCGCTTCAAGGCATCTTCCGGCGTCAGCCGTG
ACGAGCTTAACAATATTGTCGAGGCATCCTTCCCCCATCTTCTGCTCCTCTGTCAGCAGCTGCTGGACCTCGACAGTGAA
GACGCTGGCGAGATGCTGCACCTGGCCTTGAAAATCTACAAGCAGGCTGCCTGGCTGGACCTGCCGGCGCGTCTGAGAGC
AGACAACATCGAGTGGTGCACCGTCTTCCTGCGCACCGTTTCGAAGGAACCGCCGGCCTGCTCTATGGCCGAGGACACGG
CCGATCGCGAGAAGCACCACTGGTGGAAGGCGAAGAAATGGGCGTACTTCAATCTCAACCGGTTGTTCATGCGGTGAGTT
CTGGAGCTTTCTTTTCTCTTTCTCGTTCCTCGTACCTCGTACTGACCCATCTGCAGTCACGGCAACACATACACTGTCAC
GACGGACAATCGCGACCAGATTGCGTTTGCCAACAACTTCACGGCAACGATTGCACCCGAGATCCTCAAGGTCTACCTGC
AGCAGATCGAGCGTTGGGTGGCGAAGCAGATCTGGCTCAGCCGCACATGTCTGTCCTACACCGTCGTCTTCCTCGAGGAG
TGCATTCGGCCCAAGGAGATGTGGCCACACCTGCAGCCACACCTGCCGAACCTGCTCACGCACCTGCTGTTCCCCCTGCT
CTGCCTGTCGCAGGAGGACGTAACGAGCTTCAGCGACGAGCCGGACGAGTACCTGCACCGCAAGCTGAACTTTTATGAGG
AGATCTCATCACCGGATGTTGCCGCCACCAACTTCCTCGTCTGCCTGACTAAGGCTCGGCGCCGACAGGTGTACGAGATC
CTCCAGTTCGTCAACAATATCGTGACTGCGTACGAGCAGACGCCGCCGGCCGAGCGGGACTATATCGCCAAGGACGGCGC
CCTGCGTCTCATCGGCACGCTGGCGCCGATCCTGCTGGGCAAGAAGAGCCCGATTGCAGAGCAGGTGGAGATGTTCCTGG
TTCGCTACGTCCTGCCGGACTTTTCGAGCGACAAGGGCATTCTGCGGGCGCGGGCCTGCGACACGATCGAGAAGTTCGAA
TCGCTGGACTGGCGCGAGCCGGCGAACCTGTTTACGGTGTACCAGAGCATCATTGACTGCATGAACGACACGGAACTGCC
GGTACGGATAACAGCAGCCCTGGCGCTGCAGCCGCTGATCCGACACGACGCCATCCGGGAGCACATGCGGGCCAACATCC
CCAGCATCATGAGCCAGTTGCTCAAGCTGGCCAACGAGGCGGACGTGGACGCGCTGGCGAACGTGATGGAAGACTTTGTC
GAGGTGTTCTCCAAGGAGCTGACGCCGTTTGCGGTGGCGCTGAGCGAGCAACTGCGCGACACGTACTTGCGCATCATCCG
CGAGCTGCTGGACCGGGCCAGCCGACTGGACGACGACGCCGAGGCCAACGACGTGGTGGACGACAAGAGCATCACGGCGC
TGGGCGTGCTGCAGACGATCGGCACGCTGATCGTCACGCTGGAGAACATGCCGGACGTGCTGCACCACATTGAGAGCGTG
ATCATGCCGATCATTCGGGTCACGCTGGAGAACCGGCTGTACGACCTGTTCAATGAGGTCTTTGAGATTGTCGACAGCTG
CACCTTCTCGGCCAAGCAGATCTCACCGGTCATGTGGGAGGCCTTTGACCTCTTCCACGCCACCTTCAAGGCCGGTGCCG
AGCTGTATCTCGAGGACATGCTGCCGGCCCTCGACAACTTTGTGCAGTTTGGCGCCGAGCACCTGCGCCAGAACCGGGCC
CGCGTCGACGCGCTCTACTCCATGGTCAACGGCCTTTTTGCCGACCCGAAGGTTGGGGGCGCCGACCGGGTGTGCTCGTG
CCGTCTGGCTGAGGCTATGATGGTCAGCCTGCCGGGCGCCATCGACGACATCGTCTCGCGCTTCATCCGGCTTGCCCTGG
CCGCGCTGTCGAGCGGGGTGATCAACGCCGACGGCACCGTCACGCCCAGCAGCGAGTTCCTCTCGACCGGTGCCGCCTCG
GCCGTGCACCAGGTCCAGCCGCGCAGCTATCGCGTCCACCTGATGGAGATGATCATCAGCGCCATCTTCTACAACCCGCA
GCTGACGCTGGCCGAGCTCGAGGCCACCGGCTGGACGAACCGCTTCTTTACCATGTGGTTCGGCAACATGGACATTTTCA
CGCGCGTCCACGACAAGAAGCTGTGCATCTCGGCCATCATCACGCTGCTGTGCCTGCCGCCCAGCAATATCCCCCCCAGC
GTCTCGGTCGGCTGGCCGCGTCTGCTCAAGGTAAGCCGAAGAGGCCGTCCGTCGTGTCTGTTTGTTCTTGGCTGACGTGC
ATCCCAGGGTATCACCACCCTCTTCCGCACCCTTCCGGCGGCGATACAAAGTAAGAGTGTATCCCAGACTTGCCCCTACA
GCGTGCACATGCACAATACGTGATACTGACCGCACAAAAGACCGTGAGGATGCCCTGAAGGACGACTTCCAGTTCGGCTC
CGGAGGCGACGACGAGTGGGACGATCAAGACGAAGGCTGGGTCGAGGAGGAGGCCCCCTTGGAAGAGACCGACCCTAGCA
TCAAGGACGAGAACACGGCCTACATTGACTTCCTCAGCGAGGAGGCTCAGAAGATCGAGCGTCTGCGCCTGCAGACAGAG
CCGGCCGACGAGCTTGGCGAAGAGAGCCTGTTGTTGGAGTCTGCGCTTGACAAGATTGAGCCCTATATGTTGTTCAAGAC
CACAATTACCCGTACGTTTTTGTTTCTGCTTCTCGCCCTGTTGTCCACGTTCTGACGATTGCAGGTCTGCAACAAGCCGA
GCCGCAATACTACCAATCGCTGCTGTCGCATCTGTCGCAGGACGAGCGAGACACGATCGAGACTGTCTTCCAGCAGGCCG
ACCAGGAGGTCGTGAATGCTCAGTCCCATATGAAGCAAGTAGCAGCCGCGGCCGCGGCTGCGATCACAGCTCAGAACGGC
ACACAGGGGTCACAGTCGATGAACTCCCCCAGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62