GenePrediction:GLEAN_5436 Details

Name: GLEAN_5436
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:633502..631152 (- strand)
Length: 2351
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:633502..633137 (- strand)
Length: 366
Type: CDS
Source: GLEAN
Position: GCSC_132:633072..631333 (- strand)
Length: 1740
Type: CDS
Source: GLEAN
Position: GCSC_132:631268..631152 (- strand)
Length: 117
>GLEAN_5436 class=GenePrediction position=GCSC_132:633502..631152 (- strand)
ATGGGCAATACGGTTTCTCCCCCGACCTGGGAAGAGCACGATCGGCCGTTCGAGGACAGACATGGACACATCCTCGGAGA
GTTTGAGGATGACTATGAACTGGCCCTTGGAGAATACGAGATTTTTAACAGAGAACGCGTCCATCAACATATACGGCCAA
CCCCAGTCAGACCTCAATGCACATACTATAACCGCGGCAACTGCCTGCGCGGCATGACCTGTAGATTTTCCCATGAGGGA
ACTCCCCAGCAGCTACCGGCTATACGTGCCCAAAACCCCTGCCACTTCTTTGCCCGAGGGAGGTGCAGGAACGGAGCCAC
GTGCCGTTTCTCGCACAACCAGGCTGAAGACGGCGAGGATCGAAAGGTGCGCCTATACGTTCCGAATGCTTTTATACATT
ACCCAAGATGCTTACCGTCGTCCGAGACAGGAGCATGACTCTATTGAGACCTGGACCCGAGAACTCGGAGGTGCATGGGT
CCAATTTGGCGACGGCGCGACCGTCAAGGATATTTCCCTCCCCTCGGATTTCTCAGCCGTTCGTATAACCAACCTCCCAA
ACGGCAGTTCCAAGCGGTCGGTTGTGGCTATACTGGCAGAGGTCGGCCTGAACGTGCCGACCAACGCGGTGCGGATCATC
ACGCACTTGGGCCAGGAAGAATGCACAGCCATCATCAAGGTCAGAGATGCAAAGTTTTCCGAGTCAGCGTGCTGCAAACT
CAAGACATACATCAAGCTTTCCCTGGACGTCGTTTCCATTCCGGTTCCGGTGCCTACAGGATCGACATTCCATCAGATTG
ACTGCAGGCAGGTGTACTGTTCTTGGCATCGTCCAACTCGCGATGCCTTCCTCGACTTCGAACAGGCGGACATTGCAGCG
AGGATGCACACTGAATTTCGAGACGGCAGGTACACGATTCTGGGTTCTTTAGTTGGAGCCGAGGCACCGATGGTCAAGGC
GACCGAGCAGGGCAGCGAGATGTGGACTGTCAAGTTGACAGGCTTGCTGGCCACCGTCACGGAACAGGACATTACCCAGG
GATTCTCTGCTACTGACCAGCCGTCGCATGTCGACTTCAGCCAGCCAAGCTATGTTGCCGATACAGACATGGATTCTGTC
ATGATCTTGTCTATGCTGTACGAACACGGTCCTCTGAAACGATGGACGCTCCAGAAACAAAACGATGGAAAAGACAAAAG
GTTCAAAGGTCGAGCAACTTTTGTCGACGAGGCACATGCCCGGAAAGCGGTTGAGGTACTGGATGGTAAGACGCTGCCGT
TCCACGATTCCGGAAAACTCTCCGTGCAGCTTGTCACCTCGGCCAAATTTAAAGTGTCAACCCCAGTTTACGATGTTGTA
AAGGGACAGATCGACGAGCGCGAAAAGACTTGGAAGCATAGCTTCATTCGATTTTCTGTAACTGCGCCTCACAGTTTTCA
CCGGATTCTGAAGCTCGAAGGCGAGGACCGCGGGCTGATCGCTGAAGCTCAAAGAGACCTGGAACGTATTGTGCATGGAC
AGGTGATGGAGAAGGACGGAAAGAAAGTCTGGTTTGCGGACTTCACCTTTGACAAAAACACATACAAGAGGCTGAAGATG
ATCGAACACGATCTAGCTATTGTTATCATCAGAGACGTTCGTTCTACCCAGTTTCGAATTTTTGGGCCAGAAGCGAGGTT
TGCAGAGGCGACAGATGCGCTCCTTTCGATCATCGCAGAGACGACGTCAACTGTGCTCCGAATCGAGCTCACACACGACT
ATGAGCGCCGGTGGGCTATCTGCGGAGGCGTCGAGGCGCTCAAATCCGAGTTGGGAAACGCCAAAGTCACTTTTGACGTG
GAATCGGGGATTCTCTCCGTTCCTGGATCCGCCGAGGACGTCGACCTAGCTAAAACCATTATCGCAAGCTGCCAAGAAGG
GCCTATGAGACGAGCACCAAACTCCATGCCGGATTGTTCGGTCTGCTTTTGCGAAGCCGAGAACCCGGTCCGCATTTCGT
GCAACCACTTCTACTGCGGCCTCTGCTTCACGAATATGTGCCAGGCACAGTCCTCTGGAACAACAGCCTTTTGCATCGCC
TGCATAGGCGACTCCGGCAATTGCCGAAAGGTCGTGACTCTGCTTGAGATTCAGGATTCCGTGCTCTCGGAAACATTTGA
GGATATCCTTGTAGCTTCCCATGATTCCTACGTCCGCCGACATCCTGATCAATTCCGGCCTTGCCCGACACCAGACTGCA
CTCAATTTTACCGCATCACACCCGAGTCGGCTGAGAGTCCAGCGATGTTCACCTGTACAAAATGTTTCGTATCCACCTGC
ACAGGCTGCCATTCTGCCCACCCCGGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62