GenePrediction:GLEAN_5437 Details

Name: GLEAN_5437
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:624535..623564 (- strand)
Length: 972
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:624535..624477 (- strand)
Length: 59
Type: CDS
Source: GLEAN
Position: GCSC_132:624038..623564 (- strand)
Length: 475
>GLEAN_5437 class=GenePrediction position=GCSC_132:624535..623564 (- strand)
ATGCTGCAGTGGGTCGGCAGCTCAGGTTGTGATGGCTTCCTGGTCTTGTCATCGAACGTGTATGATTCATAGTAGCGAAG
GAGAGTTCGAGGCGACGAAATCCGGTCCTTTTGAAGGAAGGTAGTAACTAGGTCCTGTCATGACGATGGTTTTGATGAGG
TCAGTAAAAGCCTCACTGTCAAAGTCGTGGCTCCACGATGAGTATAAATACATCGTTCGCGGCATCCAGGATTGTGCTCT
TTTCCTGGAGAGGAGCAAGCAGAAAATCACTCTTGCTAGGCCGTAGCCAGAATTATCGGAAAACGAACGCAATGCATCCG
AGGGACAGACAGATACATCCACGGGGCCAGGGGCCAAGCAGGCCCTCCTCCGGGTATGATCTCTGCGAGACATTTCGCGA
GCTGGTGATTGAAAACCGGGATACTATCACTACACGCACTGACAGGAAACGTAGCTTATTCTCACTGTCGGGAGAGTCAA
CACTGGAACGGACACAGACGTTCGAGCAGAGTCCCAACAACCGGCGAGGCAGAGGCCACTGGTGGCATCGCGACGGCGAA
GTATCAAGGCGGCCGCTCGAGAACTGTCTGCACGGCCGCAGCGATCATGGCTATCGACACACCATGGAAGAAGATAGGCG
CCGGGAAGAAGGAGAAAGCTGGGAAGAAGCGAGGTGCCGAGAACAGCAGAGGCGTGAGGACGAGCAGAGGCGTGAAGACC
TACGGAGGCGTCGGGACCAGCAACTGCAAGAAGAGCAGGAAGTGCATCGGGAATACCGAAGGCAACATCGCCAGGAAAAT
GAATGGCATAGGGAACAAGGCTCGACTCAAGCATACTTTGAAAATCAGAGGCAAGGGTACCAGGGGCAGTCCCGACATCA
TGGCCATCGAGGCCCTCACGAGCACCACGGCCATTCCAACCAGCATCCCCACGAACCACCCAACCGGGAGACTCAGCTGG
TATCGTACGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62