GenePrediction:GLEAN_5441 Details

Name: GLEAN_5441
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:611288..609185 (- strand)
Length: 2104
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:611288..610621 (- strand)
Length: 668
Type: CDS
Source: GLEAN
Position: GCSC_132:609749..609185 (- strand)
Length: 565
>GLEAN_5441 class=GenePrediction position=GCSC_132:611288..609185 (- strand)
ATGCAATATCCAACGATCCCAATCAGCGAAGTACAACACGAATCGACCGCTCCCATCATCAACATCAACGACAACAATAG
CATCGAATTAGACAAAATCATCGACAAAATGGCCTACGGAAATGGGCAGCCCTCTGAGAGTATACTCAGCACTCCCTCTT
CAGCGAATCGATCGGTCATCCCCGGTTGGCTGGGGCTTCCAGTCCCTTTGACACCATACAACTGCGACGTCATGGACAGA
ACTCTGGCAGACTGGTCTAGACTGTTGAACTCGGCATGTGCAATAATTAGTACCTTGAACATGGGTCTGTATCAGAGGGG
TTCGATGGCCGAAGTTGGCAGTGTCCTTCACCACACCCGTCACCTTGCCAATCGCCTAGAGATCCTCGCTAGCCACTATC
ATTCACTCGCCCTCCGGCCAAACCCCAATCTCCCCCCTCGCCTCGTCCTCCGCGACTGGCACGTCTTTTGGAACTGTATT
GGCGTGTCTAACGTTTTTCAGGGACTCCTCCAACTTACATATATGCCCGCCCTGTTCATCGTATGTGACCATATACAGCA
GATGTCTGCACGCAACTGGACTACTACCGAGGCTCTATCCATAATTCTTGAGGTCTTGCAGCTACTGACAGACATTATGG
ATCAGTTTGGCACCTTCTTTAATTACGTGTAAGCTTAACAAGAAGTGGCGTTATAAACAGTCAGTACAAAATCGTAAATG
CTATTATGCATTTCTCCTCCCTTTTCACGCTGTCGTAATATCCGGGGTAATATCCGGATGTTGCGGGTTGAGTTAGATAT
TACGGAAGTACTTGCGAGTAGACTTGAATCGAAGCAACCTTGTAAACCACAGACAAAGAGAGAAATATGGGCTGTCTTTC
TAACAAGTACTTTTGGCATTCTCTTCTTAATGTACGCAACATCCTCGCTGCAGTATATGCGGTGCATTACCCAGTATTCG
GCGTGTTTTGTGTAAGTTTACTGATTTAGAGGGTTCCTTGGACTTTCCAAGGGCTCTCTACGTCACTTTGTCTTCCCCTA
AATACGCTGCAGCCCCCTAAAATGCACATGACCTAGTTATCTGAAGAACCTGGGGAATTAAAACGCGCATCGATTTTCCA
GCACCGTTATCGGCCACGGCCCTGGAGTGCACGAGGTCCTTTGTGCTACGTTGGTTTTCATGGAGAATGATTTACTCGGG
GGGGGGGGGGGGGGAGCTTTAAAACACTTTTATTATTTCCAGTCTTTCAGGTAATCATCTCCATATCACCTAGCAGCATT
TGTCAACCTGCCGGCCCCTTTTTTATATCGTTTAATCGCCGCGTGCCAACCAAGAAGGCCTTTCATCACCAACAAATTTA
CAATATTATGGCCTGTCTCGACACTCTCCCTCTTGAGCTTGTTTTTCTCATCACCTCATATCTGCACGTATCTGATATTG
GGTCTCTTCGCGCTGTATGTCGCGACCTAGCCTACAAAGCAACCGAAGAACGGTTAGAGGCTTGCTTCAAAGGAGACAAA
ACGGTCCGGCTGACGCTAGCGGACTCGAGAACTTTGTTTGCATCACCGGCAGCAGCACGTTAGCTTGCCAGCTGCAGGGC
TGTATCATCACGGGCACGCTGGACGAGTGGGTAGCCAACCACATACCCGAGAGTCCGGCTCTGGCCACGCCGAGTGCCCG
GATCTTTGAATACGTGCCAGACGACAATCCTGCCTCAGAACTGCTCGCATCCGACCTACCACTGGCCGGCCCAGACCCAG
AGCAGAAGGCAATGTACACACAGCTCCTACAGCAGGCTTTTGGTCACATCAAGGTGCGGTCGCCACATGGGTATCTAGGC
TCGCTCTGTCTGCGCGTCACCACACCCGGACCACCGTTTCAGGAGAAAATCCCCAGCGAAAGCGACCCGGGGGGCAATAA
GCCGGCAAAGTGGCATCTGGTGTGGATGGGCATATGGGACATGGCACAGTGCACGTTTGACATGACCATGGAGGCGCTAG
AAGCGTCTCAGCTCCCTGTGGTCATGTCCCTAGACATCTTCGGCGATCAAATGTTCCGCAGCCTGACCAGCGATCGGCTG
GCCTGGTTGTTCTGGAAGCGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62