GenePrediction:GLEAN_5443 Details

Name: GLEAN_5443
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:602927..600870 (- strand)
Length: 2058
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:602927..602899 (- strand)
Length: 29
Type: CDS
Source: GLEAN
Position: GCSC_132:602729..602622 (- strand)
Length: 108
Type: CDS
Source: GLEAN
Position: GCSC_132:602565..602136 (- strand)
Length: 430
Type: CDS
Source: GLEAN
Position: GCSC_132:602067..602013 (- strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_132:601951..601663 (- strand)
Length: 289
Type: CDS
Source: GLEAN
Position: GCSC_132:601602..600870 (- strand)
Length: 733
>GLEAN_5443 class=GenePrediction position=GCSC_132:602927..600870 (- strand)
ATGGCCAATCCTATCTCGGTCGAGTTCGGGTCAGTCTTCAATACTGGAACCCCTTCTGGTCTTTCATCAATCCCGTCCCA
CATCCATAGTGCGCATACAGGCGATTGCAGCCTCGATGTCGACTAATCTGGAAGATGCTACCACCCAGTCTCTGAGAACA
ACCCAGCGCGCGCCTCGAAGCTGTCGGCCATGTTCTAGTCGCAAGGTCCGATGCGATAAGGCGGTGCCATGTTCGACCTG
CATCCGACGGGGTGAGGCAGAGCTTTGCGTCCGCGAGACGGTCATCGTCAGAGGCAACGTGACCGTGTAAGTTGATTCTG
TATGTTGGGAAAGAAGCCAACTTCGGTCTGACGGTGAGACAGAGCCCAGGACTCCGATCAACAGCCGACATACGAGCAGC
TGCTTGTCGAGATTGCACTGCTGAGGCAGCAACAGGTGCCACCGCAACCACAGCCGCACATTCTTCCGGTGCCGTCACAA
CAGTTGGATTACAACGCAGTCCATCTGACCGTTGAGAGGTCACGTGCACTCGACGAGACCCTGTTCCAATCTGCGGCACC
ACACCTCCCCACTTCTAACCGCATCGGCTGGGACTCGATCATCCTTCCCAGTACGCAGTGCAGCATCGGCCTGGTCGAGT
ACGACAAGATATGGAACTCGTGGGTGCACTACGCGATCGAGTATCCGCAGTTTGAGCACGAGCACAACCGCTTTCTACTC
GCACTGCAATCCGGCACACCGCTACACGAGTACGATGCATCATGGCTGGCTATCTACTTCAGTGTCATCACAGTAGGTCA
TACTAGATGCGCGTGGCCGTGTTACTGGAAATCTGAGCAGGAAACTAACGCCATCACCAGGCTGCATTGCTGACCATGGA
TGATGAGGAGGCGAATCAATTAGGTCTCTTAGCCCGTGAGTGAAGGTTTCTGGCCGTGAGACCATATAGAGACCTGTCCG
ATACTAACAGATTTAGTAAACTACGACTACACCACTCTGTTGCGCAACTGGTATGATGCTTCACTTTTCTGCTTACACCA
GGCAGACTTTATGCGCCGGCTGGATATGCGGACAGTGCAAGCTGTTGCCATCCTGGGCATCTGCTTTGTCAACTTTGGCG
ACAAGCACCTGTACGAATCCATATGGGCCTGCGCCTTTAGTATTGCACAGCGTCTAGGACTTGACCAGCCGGGCGTTTCT
GCTGCTGATGGGATGAGTCAGGAGGCCCGCCGGCGGCTGTGGTGGACGTTGGTTATTTGTGACTGGTAAGGACGAGGACA
GCTTTCTGGTCCGTCGAGGCTTTCTGATCAGCTGACAGTCTCCAGGCTCCAAGTGCCGTACCGCATCCCGATAGTGAGAG
ACGGCGACTTTGACGTCGACCTGCCATCGGTGGAGGGCAATCCAAGGCCGATTGGGTCCGATGGCCGTTCCATTCACCCG
GTCCACTACCACACCTTCATGGCGCGGTGCTCGAGAGTCTGGCACCGCTTCCAGGCCGCCCTACGTACGACGGCTGGTGC
GGCCACCCTGGATGATACGGTGCGGCGGGCGGACTGTGAGCTGGCCGAGATTATCGATACGTTGCCGCACTACCTGCAGC
CGGACCGACAATATGAGGCAGACGAGCTGGAGGCGACATATCCGTGGATTGTGTGGCAGCGCTTCGACATCACGCTCGTG
CTGCTACACCTGCGACTGCGGGCCAATCAGGTGCTACGGGACACGTGGTCAGCGAAGACGACAACGAGGACGACGCCGAT
GCACCATCCGTACAGCTGGGCGCGGAGCCTCTGCATCGCCACAGCCCGGGAGCTCATTTGGATCTGCCATCACTGGCACC
AGCCGGTGACGAAACGGCGGCAGTGGGCACTGTCGTTCTACGTCTTCAATGCTGCTAGGCACCTCGTCGAAGAGTGCCTT
GAATGGTCAACTACGGATATGGAGAAGCTCGCGTGGCGCTCTGATGTTGCCGTAGGAATGGCCTACCTCGAAGCCATCCA
GTCGCACAACGTCATCGCGCAGGAGGGCGTACAGATCCTGAAAGGGTTGTTGCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62