GenePrediction:GLEAN_5444 Details

Name: GLEAN_5444
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:590735..589034 (- strand)
Length: 1702
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:590735..590637 (- strand)
Length: 99
Type: CDS
Source: GLEAN
Position: GCSC_132:590567..589795 (- strand)
Length: 773
Type: CDS
Source: GLEAN
Position: GCSC_132:589738..589352 (- strand)
Length: 387
Type: CDS
Source: GLEAN
Position: GCSC_132:589295..589034 (- strand)
Length: 262
>GLEAN_5444 class=GenePrediction position=GCSC_132:590735..589034 (- strand)
ATGTCGCGCTACGAGCGCAAGTACGTCTCGGACCTAGTCCCTGGCAACATCAACCTTCTCACTACCCTTCTTGTCGCAGT
GGCCGTGGTTAATTCTGCAGTACGTGTCTGGACCCCGTGAAAGCCCGACAATGCAAGATAAGGCGTGACCAATTTGCTGA
TCCTCCAGACCCTCGGCTACGATTCTTCCGTCATGAATGGGCTTTTGATCCTGCCCTCGTACACGGAGTACTTCCACCTC
AACACAGCTACCACCGGCCTTAATAATGCGGCCTCCTGGATGGGCGGTATTATGGGCACGTTTCTCATGCAGCCGCTGCC
AGACCGCCTCGGCCGCAAAAATGCCATCGTCGTTGCCGTCATCGTCACCACCATCGGCATCATCCTGCAGGCGGCCGCCC
AGAACATTGCCATGTTTGTCGTCGCCCGCATCATTGTTGGCATTGGTTCGGCTATCTCCAACGCCTCGGCCCCCATCCTG
CTCGGCGAGCTGCTGCCTCCGCGATCGCGTGGACGTGTCCTCGGCATCTTCTTCTCCTGCTACTACGTCGGCTCGCTTCT
CAGCGCCATCATCAACTACGGCAGTCAGAATATCCAGTCCACCTGGTCTTGGCGCTTGCCGTCTTTGTTACAGTGCATCC
CCAGCTTTCTGGCCGCTGTGCTTCTGCCGTTTGTGCCCGAGTCACCGCGCTGGCTCATCTCTCGGAACCGCCACGACGAG
GCCCTCGAGGTGCTCCTCGTCATGCAGGGTCGCGCTGCCGAGAACATTGACACGGCCAGAGCCTCACTGGTCGACATCCG
CACCACCATGGCTCGCGAGTCCGCCATGTTTCCCCGCAACCCGTGGCGTGAGGTGTTTTCGACAAAAGGCAACAGGAAGC
GGCTGGTCATCCTGGCTGCGTTTGGCTGTATGATCAACTCGTGGGGCAACTTTATCATCTCGTAAGTCAGCCTGTGAAGT
TGGCTCTCAAGAGGCGTTCATTCGGCTTACCTTGCAGTTTCTACCTCACCAAGATCCTCGACCAGGCCGGCATTAGGGAT
ACCGTCACCCAGACCCAGATCAATGTCATCCTCAACTGCTGGTCCTTTGTCGTTGCTATTTTTGGCAGTTTCATGCTCGA
CGTGCTTGGACGACGCAAGCAAACCATGACTGGTGCCGTCGGTATGATCATCACTCTTTTCGTCACCGGTGGCCTGATCA
AAGTGTATGGCGAAAGCAGCAACAAGTCTGCAATTTACGGAACGATCGCCGTCATATTCCTCTTCCAGGGTTTCTACGCG
TTCTCCATCACGCCTATGACCAGTCTGTATGCTACCGAGGTATCACAGTTCAAACTGCGGTCCGTGGGAATTGCTGTGTT
CCGCTTTTTCGATAGCAGCATTGGGTACGTTCGTGTTCCTTTCCAACTGTTGTCGGGTAGCCTCCCTAACGTGTGCACAG
ACTCACCTTCTCCTTTGCAATGTCGTACGCCATGGCAAATCTAGGCTGGAAGTTCTACCTCATCAATGCTGCGTGGAACA
TCATATACCTCGTCATCATCTACTCCACCTTCGTTGAGACCAAGGGACTGAAGCTCGAGGAGATCGCCGCCAAATTCGAC
GGCCCTCTAGCTCTTGAGGCAACTGAAGGGGACAGCGAGACCGAACCAGGTTTCGGTGACAAGAATGTACGAGTAAAGAC
GACCCTCTCAGAAGAGGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62