GenePrediction:GLEAN_5448 Details

Name: GLEAN_5448
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:559993..558708 (- strand)
Length: 1286
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:559993..559780 (- strand)
Length: 214
Type: CDS
Source: GLEAN
Position: GCSC_132:559723..558708 (- strand)
Length: 1016
>GLEAN_5448 class=GenePrediction position=GCSC_132:559993..558708 (- strand)
ATGGAAGCCGTAGACATCTCGCCCTCATTCCAGCTGCAAGAGCTTCCTAATTCTAAGGCGGGCTCTATCCGCAGCACTCC
GATGAGTAGCCAGCCGATCGACGTGGCTAGAGAACCATTAGCGCCAGGATCGGACGCCCCTGTGAATGCCAAAATCACCA
CCAGGGCTTGGCTCTCCATTGCTGGCTCCTTCTTATTCCTCTTCACAAGCTATGGTGCGTCTCTCAGGGACCGAGATCGA
GCCCGGACCAGCAGGACTGATGGTGGACAGGCTTCATGCAGACCATCGGCACCATCCAGGCCTACTTGGAAATACACCAG
TTGTCGGCGTATAGCTCGCGGGACGTCGGCTGGATAACCGGTGCCTTCACGGCTCTGACCTTACTTCTCGGTATCCAGGT
TGGGCCTCTCTTTGATGCGTACGGCCCGCAGTATCTTGGCCCCGTGGGCTGTCTGGTCTACATCCCTGTGTTCTTTGTGC
TGGCCGAGTGCCACACCTATTGGCAATTCATGCTTGTGATGGGCATCTGGGGCGGCATCGGGGCTGCCATTGTTTCCATG
GTAGGTATCGGCGTCATCAGCAAGTGGTTCACTCGCCGTCGAGGCATGGCCATGGGCCTAGCACTCTGCGGATCGAGCGT
TGGTGGCGTGGTCATGCCGCTGATGCTCCGAAAACTCCTGCCTACTGTTGGATGGGCCTGGTCCATCAGGTCGATTGCCT
TTTTGCTTTCAGCCATCATGATTATAGGTGCTCTATGTCTGCAGCATCCGCTTCCTAGTCCGCCTTCTGGTATTCCGTTG
GCAGTGCGCCGCAAGCGAGCCGTTCTCAACTTTAAGGCTCTCAAGAGCTGGACCTTTGCATTTGTGACAGTTGGGCTTTC
GGCTCTGGAGTTTTCCATCTTCGGTATCTTTTCTCTCCTCCCAACCTATGCAATGGTAGCCGGCTTCAACTCGGATACCG
GCTACACCTTAATTGCCGTTGCCAACGCAACCTCTACGGCCGGCCGTTTCCTTTCAGGGCTGGCTAGCGACCATTTTGGG
CCATTCAATACCATGGTTTTCATGGTTCTTGTCACCACCATCTTTACTGCTTCAATCTTTGTTCCCTTTGGCTCAAGCTC
GTTAGGCGCTCTGACCGCTTTCTCCGCACTCTGGGGCTTTGGGAGTGGCTCATTTATCTCACTAGCACCGGTTTGTATGG
GGTTGATATGCGAGACGGAGGACTACGGGAGATACTTTGGTCTGTTCCCGCCATTTCCTTGTATCATCTCTTTCTCGGCT
AACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62