GenePrediction:GLEAN_5449 Details

Name: GLEAN_5449
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:555448..554467 (- strand)
Length: 982
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:555448..555024 (- strand)
Length: 425
Type: CDS
Source: GLEAN
Position: GCSC_132:554959..554467 (- strand)
Length: 493
>GLEAN_5449 class=GenePrediction position=GCSC_132:555448..554467 (- strand)
ATGACAACTGCCATTACCATTATGTCGGGCGACCAACTCGAGAAGGCTATTGCCTGCAATCGTTTTTACCACCGCAGCAG
CTCGGCCGCCTTTCCACCGGCCCAGTTCGCCAGTTTGGATCCGGAGTCGGCCATCTTTGCTGCGGCCGTGGCGCGGTGGC
AGCGGGACCATGCCCTCAACATAGACGGCATCCTGGGTCCCAAGACGGCCGCGGCCCTCCAAGGGCGTACATGGAAGTCA
CCCAAGGGCGAAAATTACCTCATCGTCAAGGGCGAAAAGGTCCCGACGTCGTTTCCGGTCGTGCATTGGACTCACCCAGA
AGGCTTCAGCTTTGAGCGGGTCATCGAGGCGATCCCAGACTTCAACGGAGTTGGCAAGCGGGCCAATCCGACGATTGGTG
GGATTGAACGCTTCGTCATTCACTGGTTCGTCTTGCACTTGCTAGAGAAGTCGACTGGTGGCAGACAGATGGCTAACAGT
GTGCTGCAGGGACGAGTGCACATCATCACACGACTGCTTCCATGTCCTTTTGTGGCGAGGGCTGTCTGTGCAGCTTTTCC
TAGACTCTGATGGCACGTTGTACCAGGGTATGGATCTGGTGAACGATTTGGGCAGACATGCTCGGTGGACAAACGAAACC
TCTGTTGGCATTGAGATCAACAATCCAGTCACACTTCGTAAAACCTACAATGTGCAAAACAGGAAGATTGTCCGAGCACA
GGAGCCGCACACAGCTGATCCGAACTGGCGGCACTTGGACTACACGGAAGTGCAGAAGTCCGTTATGAAGCAGCTTGTGC
CGGCCATATGTGATGCTTTGGAGATCCCGCGCACGCTGCCACAAGACGACAGCGGCGAGGTGCCCAAGGGCTTGATTCCG
GACCCAACCGAGTACAAAGGGGTGATGGGGCACTACCACCTGCAGACAGACAAAGTAGACCCTGGCTACACCTTGTGGCC
GCTGCTCTTGAAGGTGTTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62