GenePrediction:GLEAN_5450 Details

Name: GLEAN_5450
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:554016..552396 (- strand)
Length: 1621
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:554016..553662 (- strand)
Length: 355
Type: CDS
Source: GLEAN
Position: GCSC_132:553594..553518 (- strand)
Length: 77
Type: CDS
Source: GLEAN
Position: GCSC_132:553453..553421 (- strand)
Length: 33
Type: CDS
Source: GLEAN
Position: GCSC_132:553361..552737 (- strand)
Length: 625
Type: CDS
Source: GLEAN
Position: GCSC_132:552673..552396 (- strand)
Length: 278
>GLEAN_5450 class=GenePrediction position=GCSC_132:554016..552396 (- strand)
ATGAGTGACGATCCGCCAGCGCCTCTCGTAAATGAGCGCCCGTCAGCGAATTTGGCCAAGCAGGTAAATGCGCCACAAAG
CACACCGGACACACAGATTGTGCGATTGCAGCAAAAAAAGCCGACGCGGGCCTTATCGCTGCGGACAGCAGCGCTTTTCG
TGTCAGCGAGCATTGCCTTAGCCGCAAAATGGAGCTACGGCGCGCCGGAAACATTTGACCCTTCCGACTTCAAGGCACGG
ACAGAACACATCCTCAGCACCACGCCACTCATTGATGGACACAACGACTTGCCCTACCTGTTCCGCTTACAGCTAGATAA
TAAAATATATGACCAGGAGTTCTCATTTCAGACAGGTAGGGACTGCTTTGCCCGTCTTAGAACGAAGTGATAGCAGCTTG
GCGCTGACGTATTTTACTACAGGATTGGGGTCACATACAGACCTGAAGCGGATGCGGGAAGGCCGCGTAGGGGGGCAGTT
CTGGTCTACCTTTATCGACGTCAGTATATTCGTACCTAGCCTGCTGCTGCTCTTGGGCAGCATCAATGCTCATACATGAA
TAGTGCCCCGACATTGTTCATATGGACGATCCAAATGTGAGTATTTCAGTCTTCACCCTCGCCACTACTTCACAACGAGC
TGACGGTTCTTCCAGCATGCCGTGAGAGATACTCTTGAGCAGATCGACGTCGCAAAACGGCTGATCGCCGAGGTGCCAGA
CTTGGAGTTTTGTGACAACTCCAAATGTGCTCGGCGGGCATTTAAGCAGGGCAAGATTCCCTCCATGCTTGGCGCAGAGG
GTCTGCACCAGGTCGGCTCTGCCCTCGCAGTAATCCGACAGTTCCACAGTCTCGGCCTTCGGTACATCACCCTCACACAC
AACTGCGACAACGCTTTTGCCACGGCCGCGACCACGGTGACGGAAACGGGAAAGGACAGCGGCCTGAGCGAGTTTGGCGT
CGAGGCTATCAAGGAGATGAACCGCCTTGGCATCATGGTCGACCTCGCCCATGTCTCTCACCGAACCATGCTTGAGGCCC
TGGACGTGACCCGCGCGCCCGTCATCCTTTCGCATACGGGTTGCCACGCACTTGCAAAAAGCAACCGCAACGTGCCCGAC
AGTGTTCTACGACGGCTCCCAAGTAACGGAGGCGTGGCCATGATCTATTTCGTCCGAAAGTTTATCAAGCCGGACGACCC
AGACAAGGCCTCGGTGGATGACGTGGTGGACCACATTCTTCACGTCGTCAAGGTCGCGGGCTGGGATCATGTTGGTATTG
GTACGTCATACGAATCCTAGTTGTGATGATGTTTGCACAACTCGGCTGACAGGCTTATAACAGGTGGTGATTTTGACGGC
ACTGGATATGTGGTTCACGGTCTTGAGGACGTGTCCAAATATCCACGGCTGATCGAGGCTCTCCTGAGACGGGGGGCGAC
TGACGAGCAAGTGAAGAAGCTTGCGGGTGAAAACATCTTGCGCGTGTGGCGCCAGAATGAGATCGTCTCCGAGACCATGA
AAAAGGCTATGAAACCGGTAGAGGCCGTATGGGAGGGGAGGCAGCCGTCAGCATCATTCGAGGGGTCAGCATTGTTGCCC
AGATTAAAACCACACTATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62