GenePrediction:GLEAN_5451 Details

Name: GLEAN_5451
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:542860..541749 (- strand)
Length: 1112
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:542860..542652 (- strand)
Length: 209
Type: CDS
Source: GLEAN
Position: GCSC_132:542597..542508 (- strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_132:542423..542200 (- strand)
Length: 224
Type: CDS
Source: GLEAN
Position: GCSC_132:542143..541959 (- strand)
Length: 185
Type: CDS
Source: GLEAN
Position: GCSC_132:541892..541749 (- strand)
Length: 144
>GLEAN_5451 class=GenePrediction position=GCSC_132:542860..541749 (- strand)
ATGGCTGCCGACAAGACGAGTCTTGAGGAGCTTTCCAACAACAACTCCAACTATCTCAATGATGAGCTCGACCAGAAAAA
TCACCTTCAAAAAATACGGACTGTCGGCAGCGTGGCCATGACGGCCGAGTTGTTCGAGAAGCTCTACGTCTCACCACAAA
CCAAGGTCAAGGGCGATCTCCGCAAGACCTTTGGTAATCCGACACCAATGTACGATGCTGCATATTCGCATCATCCCATC
TAGCTATGGCTAACACTCCACAGTGCTCTTGTAGGCTTCATAATGGCCTTGACACCACTCTCCTGCGATCTCATGGGCTG
GCGAGGCGCTGGTGGAAGCGGCGCAGCTGAAATGTGAGCGATCTCTGTTGTCTTTTGTTTCGTCGTGCAAATCCTCCCCG
CTTTGGGATTTCCTTTGTCACTAACCGCCATGCACAGAGGTGCCTACTACTTTTTCGGCGGCCTCCTGCAGGTAATCACC
GGCCTGCTCGAATGGATTCTCGGCAACACATTCTCATCTGTCGTCTTCTCTTCCTTTGGTGCCTTCTTCTTGACATTTGG
CGCGACATTGACCCCGTCATTCGCCGCATTCTCTACGTATGCCGTGGCTGGAGACCCTACAAGCACTGGACTTGAGACTA
AAGGATTCAATGCAAGCTTTGGTGAGAACGTCTGCTGCTTGACGGCTCCTCGCGAACATTGCTGACTGACATAACAGGAT
ATTTCATGTTGTTTATGGGGCTCCTTTGCGTCGTCTACCTTATTTGTGCCTTGCGGGTAAACATCTGCTTCGTTATGATC
TTCTTTACGCTTATTCTTACATTTTCCTTCCTGACGGGCGCCTACTTTGTACTTGCAATGAACTACACTGGCAACGCGGT
TCTGTCAGCGAAACTTCTCAAGGTATGACCGATGACAACGGTAATGTAAATGGCTGTCTTAGAGACCCAGCTAACATTTT
GTCCACAGGCCGCTGGCGCTTCAGCATTCGTCACGTCTGCTTTTGGCTGGTGGACATTTTTCGCCATGATGCTTGCCAGC
ATCGACTTCCCAATCTCTCTTCCCGTCGGCGACTTAAGCAAGATGATCAAACCAGCTAGCTCTAAAGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62