GenePrediction:GLEAN_5452 Details

Name: GLEAN_5452
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:537409..536290 (- strand)
Length: 1120
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:537409..537384 (- strand)
Length: 26
Type: CDS
Source: GLEAN
Position: GCSC_132:537332..537253 (- strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_132:537183..536447 (- strand)
Length: 737
Type: CDS
Source: GLEAN
Position: GCSC_132:536391..536290 (- strand)
Length: 102
>GLEAN_5452 class=GenePrediction position=GCSC_132:537409..536290 (- strand)
ATGGCCAAGAAGGAGGTACTCGTCTGGTAGGTGGCTTCTACCGATAACAGAAACAAGCGCCCTGGCTGACAGACCAGCTA
TGGCGTCGACATTGACGCAGTTGCCGGCTGGCTGGGATCGTACGGTGGCGAGGACAGCACCAGCGACATTAGCAGAGGTA
GGTGTTCTTGTCGATGCCGGGCTCTGGCCAGACCTATTTCCACACGCTGACATACCCCTTCTGCAGGCATCTGGGCCGGA
ACCGAGGGCACCCGCCGGCTGCTGAAGCTGTTTGACAAATACAACATCAAGGCCTCATGGTTCATCCCCGGACACACGCT
TGAGACCTTTCCCGAGGAGTGTGCCATGGTGCGCGACAGCGGCCACGAGATCGGCCTCCACGGCTACAGCCACGAGAATC
CTGCCGACATGACCTTTGAGCAACAGCGCGACGTCCTGGCCAAGACCTGGACCATGCTAACCGATTTCTGCGGCAAGCCG
CCGCGCGGCAGCGTCGCCCCCTGGTGGGAGACCAGCGCCGAGGGCACTGAGCTGCTGCTGAGCTACGGTATCGAGTATGA
CCATTCTATGTCCCACCACGATTGCCAGGCTTACTGGCTGCGTACCGGCGACACTTGGACCAAGATCGACTACACAAAGA
AGGCCGAAAAGTGGATGAAGCCGCTCGTTAAGGGCAAGGAGACCGGCCTCGTTGAGATCCCCGGCTCCTGGTACATTGAC
GACCTGCCACCCATGATGTTCATTAAGAATTCTGCCAACTCCCATGGCTGGGTCAACCCACGTGACATTGAGGATATCTG
GCGGGACCACTTTGACTACTTCTACCGCGAGTACGACGAGTTTATCTTCCCCATGACTATCCACCCCGACGTCTCTGGTC
GGCCCCATGTCCTGTTGATGCACGAGCGCATCATCGAGCACATAAACAAGCACGAGGGCGTCCGGTGGGTCACAATGGCC
GAGGTTAGTTGTACCACCCCCTGTGAAAGAGTGAAAGTTTATGTGCTAACTAATGTAGATGGCCGACCATTTCAAGAGTA
AAAACAAGCCGCCTGAGGGCGCTTTGATGCCGGCCACGCCGGAGGAGGTGATGAAGAAGTACGGCAAGCCAGCTGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62