GenePrediction:GLEAN_5453 Details

Name: GLEAN_5453
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:526129..524498 (- strand)
Length: 1632
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:526129..525719 (- strand)
Length: 411
Type: CDS
Source: GLEAN
Position: GCSC_132:525661..525378 (- strand)
Length: 284
Type: CDS
Source: GLEAN
Position: GCSC_132:525325..525261 (- strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_132:525207..525129 (- strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_132:525068..524959 (- strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_132:524910..524689 (- strand)
Length: 222
Type: CDS
Source: GLEAN
Position: GCSC_132:524640..524498 (- strand)
Length: 143
>GLEAN_5453 class=GenePrediction position=GCSC_132:526129..524498 (- strand)
ATGGCTCTGAATGTTGCAATTATCGGCGGCGGCATTGCTGGCTTCTCGGCTGCCATCTCTCTGCGTCGTGCCGGCCACGT
CGTCCGGGTCTACGAGCGATCGTCGCTCAATAACGAAGTCGGTGCCGCCATCCACGTTCCGCCCAACGCTTCCCGCGCCC
TCTTAGCATGGGGACTGGATCCTGTCGGTGCCAAGTTCGTCACCACAAAGTCCAGCTTCCGCGCCTTCGCAAAGACACTG
CAGAGATTCCACGTGGGAACGACCGAGGCCCAGATCCCGCTACAGTGTGGTGCTCCCTGGTTCCTGGCCCATCGTGTCGA
TCTGCATGAAGAGCTCAAGCGGCTCGCCACCTCGCCCGATGGCCAGGGCACTCCTGCCTGCGTCTTTCTCAAGTCCGAGG
TGGTGAAATATGTATGCTTCCACAACTCTACAAGCACACATGTTTCGCAGCTAATGCGGTGGAACTAGAACGCAGATGCA
CCCTCAGTGATGCTCGCGGATGGAAAGACCATCGATGCCGACGTCGTTGTTGCTGCTGATGGAATTCACACCAGCGCCGT
CGAAGCGGTCTTGGGACGAGCAAACCCGCCTGAGCCGTCCAAGGACCTCTACAACTTCTGCTACCGCTTCCTCATCCCCG
CTGCCGATCTCGAGGCCGATCCTGCGACCCAGTTCTACAACCAGGACGATGATGGTCGCATGAAATTCTTCACTGGCGAT
CTGAAGAGGATTGTCTCATATCCCTGTCGGAAGTAAGTTTTGTTCCTACCTTCCGACAAGGCGACCACGACCTGACGTAG
CTAGCAATGAGGTGCACAACTTCGTCGCCATATTTCATCAGAATAATCTCGACCTGATGAAGAAAGAAGGTAAGCAAGCT
AGATAATCTTAGTCTGCAGCTGCAGTACTGACAATAACGCAGACTGGCAGGCTTCCGTCGACAAGGGAAAACTTCTCGAG
AAGTACTCCGACGTTCATCCAGATCTCTTTGCTGTTATCAGGTAAGATAAAAGCGGGGGTTTTCTGCTGCCAGGCTGTCA
ACTGCTTCTAACGACCCGCAGCAAAGCAACAGAAGTGAAGCAGTGGGCATTATTGTTTCGACCGCCCATTCCGACCTGGA
CAAATGGAACCTTGGCACTGGCTGGCGATGCTGCCCATCCTATGCTTCCTCGTATGTGCAACATGTCTCCGAGTACTTTC
TCAAACTAACACCTTGCAGATCAGGGACAAGGTGGTGCCCAAGGCATCGAGGACGGAGTCGTTCTCGGAATGGTCCTCGT
TGGTGCCACCAAGGAGAACACGGCCGAGAGACTGAAGCTGTACGAGAAGATCAGACGGAACAGAGCTAGTCTCATCCAGA
TTTTCAGTAATGCCGGCCAGGATGAGCCAGAGCTCATCCGCAAGGATGCATCTGCCTTCATGCCAGCAGACAAGGTCCCA
AGTAAGCATCTACCCATGACACACATTAAGCGCCTGTTAACAAAAACAGCATGCCCAGAAGACTTCTTCGATTACAATTT
CAGCTACGACATTGTGCAAGACACGGTCAACCATCTCAAGAAGCTCGTTTCTCAGTTTAAGCTTCCCGAAACCTTTTTTC
AAAACAAGCCTGGGAGAGGTGCTTACCCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62