GenePrediction:GLEAN_5459 Details

Name: GLEAN_5459
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:496559..495199 (- strand)
Length: 1361
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:496559..495760 (- strand)
Length: 800
Type: CDS
Source: GLEAN
Position: GCSC_132:495634..495199 (- strand)
Length: 436
>GLEAN_5459 class=GenePrediction position=GCSC_132:496559..495199 (- strand)
ATGTTTCGCTTCCTAGGCCTCTCTCAGGATGCTTCTCCGGCCAAGCCACTGCCCAGCCGTGGCCTCGCCTCGTCCTGGTA
TCGCAGCCCGGCCATGTACGAGCTCGAGCGCCGCGCCGTCTTCTCGCAGCGCTGGCTCCTCATGACGCACACGCTGCGCT
TCACCAAGGCTGGCGACTACGAGTCCTTTACCGTCGCCGGCTTCTCCTTCTTCCTTGTGCTTGATCGCACCGGCCGCATC
AACGGCTTCCACAACATCTGCCGCCACCGCGCCTACCCAATCGTCGAAAAGGCCTGCGGCAACGCCGCCGTACTCAGCTG
CAAGTACCACGGCTGGTCCTACTCCTACCAGGGTGGCCTCGCCAAGGCCCCTCGCTTCGACACTGTCGATGGCTTCGACC
GCGCCCAGCACGGCCTCCTGCCTGTCCACGTCCACGTTGACCGCGCCGGCTTCGTCTGGGTCAACCTCGAGGCCGGCACG
CCCTCCGTGCCCTGGTCCGACGACTTTGCTGGCGTCGACTCCACCATGGCAGACACCTACGGCTTCTCCGGCTACCACTT
CGATCATCGCTGGGACATCGACCTCGACGCCAACTGGAAGGGCGTGGTCGAGAACTACAACGAGTGCTACCACTGTCCGA
CATCCCACCCGCTCATCGCCGGCGTCTCCGACCTTACAAAGTATACCGTCGAGCCCAAAGCTGGCGCTTTTCAGCACACC
ATCGTCAACAAGGCCGAGTCCGATGGCAACTTCCGCCGCTCCATCGTCTACCTCTACCCATTGACCTCTATCACAGTCAC
GTGAGTCATCTTTGTGTTTGCCTGCATATATGTGAATATGCGTTCTTGCACATACGCATATACGCATATACACATACGCA
CGTTCGCTTACTCTCATGCCCTCTCACCCACACTAACTCTCCCAGCGATAACTTCTTCTACATCCAGCGCATGGTTCCCA
CATCTGCCACCACCACGCGCATAGAGAACGACGTGTTCCGCCATGAAAAGGCCACGGACGCCGAGTTCCAGGCCATCCTC
GACTTCTACCATCAGGTCCTCGGTGAGGACAAGACCCTCTGCGACAATGCTCAGGCCAACATCAACGCCGGAGTCTATGT
CAATGGCGAGTTTCACCCGCAAAAGGAAAAGGGGCCCCTCTACTTCCAGGATACCGTCCGGACACAGGTAATGGCCCATC
GCGCCAAGGAGGAGAAGCAGGACGGCCGCCCGATCTGGCCGGCCACACCCAAGATCGCCGGCGAGATGAAGACGGACAAG
CTCGACGAAGAGGAGCGCTTCTGCGCCGGCCTCGAGGCTGCCGGCGGTTGCGCCGCCTCCAAGTCAGAGTTGGCCTGGTA
G

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62