GenePrediction:GLEAN_5461 Details

Name: GLEAN_5461
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:491744..491023 (- strand)
Length: 722
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:491744..491560 (- strand)
Length: 185
Type: CDS
Source: GLEAN
Position: GCSC_132:491489..491276 (- strand)
Length: 214
Type: CDS
Source: GLEAN
Position: GCSC_132:491157..491023 (- strand)
Length: 135
>GLEAN_5461 class=GenePrediction position=GCSC_132:491744..491023 (- strand)
ATGCCCGAACCAGGGCTATACACACTCCGCATTATCGCCTATGACAGCAGAGTCCAGATTGACACCTATCCGTTAGCTCC
TGCACGTATGCTGGGCATTGAGTGTCCGTTGCTAAACGCCAAACGCAAGCTGGACGACGTCCTTGCTCCTAAAACTCTGC
CCACGGGCTTCCTACAGCAACTGGGGTACATAGTCCAGCCTTCGGTCTGCTTTTATATGATTTAATCTAATCTGCAATTA
GAAATCGGTCTGTAGGCACAAGCCGTTTGCCGCATTCGCACCCATCTCGACAATTTCGGCTCGAATACAAAACTCCTCCA
ACCACACCTACGATGACCACGAAAATGCGATAGCCAGACAAGAGCGAAGCTACTCTCTGACCTCTGCCTTCCTCTACAAC
GTAATATCTGGCGAAGCTGAGGCAGGAAACGTGTCACCACCAGCTCGTTGTCGATGGAGGGCAGCCGTGGTATGCAGCTG
GCCTGCCTGAGAAGATTTCGAGACACCCTGGAGAGTACCCTGGCCATTCTGGCGACTGGGACGGGCTCAAGCGCAGTTGC
TACGATGGTCACAATCGCGAGTAGCAGGCCAGGAGACAAGACTTCGACGGGAGCGTGTTCGAGTACACTGAGTGGGCCAT
GAGATTCCTTTCGAACCTATTTTCCTACGAGGCACCAGTCCAAATCGAGTTCGACGACGTTCTAAGCAACAAGACCGCCT
GA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62