GenePrediction:GLEAN_5462 Details

Name: GLEAN_5462
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:483705..482512 (- strand)
Length: 1194
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:483705..483625 (- strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_132:483545..483352 (- strand)
Length: 194
Type: CDS
Source: GLEAN
Position: GCSC_132:483034..482945 (- strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_132:482866..482512 (- strand)
Length: 355
>GLEAN_5462 class=GenePrediction position=GCSC_132:483705..482512 (- strand)
ATGTCCGGGATCACGCCTCCCACCTTGGCGACAGAGTCGCCAACAGGAGCGTCCGAAGCGGTGGTCAATACACTAGGACT
GGTATGGCCCTCTCTTTAACTCAATTTATACGCACAACCCAAATAAAACCTCCAAAAATACAAAAAACCTAACTTACAAG
GATCCCGGTCTTAGTGATGATGACGATGATGCCGACTCTGCTTACAACTCGAATATTCAGTCGTCTACCGAGTCTTTGGC
ATCCTCTATTATTCAATACCGGACTCTTCACGGGCGCACTTACCATAGTGAGCGCGGCAATGCACAATACTGGGCTGCAA
ATGACGAACAGCAGAGCATTTCGCTTGACCTTTTGTAAGAGCCATGTCAAGCTTAGTCGTCACATGTTCTTACAATGTTG
TAGCCATCACGCGTTCACACTTTCACTTGACGACAAACTCTTTTTAGCACCACTTAAGGATCCTAAGGTACCTACTAAGA
CGTTTTATCACTTATCTAAATTCACTAATGTTTCATAGAATGTCCTGGATATAGGAACGGGAACTGGTGCGTTTTAGACT
TTTTAAGGCATTTGAAGATACTCGGGCTGACAATTGTCCGTCTAGGCTTTTGGGCGATGTATGTGTTTAACGAAAGCAAA
ATGCTATTTCTACATATTGACACTGCCATAGCGACTTTGCCGACGCACATCCTGATTGCACCGTAATTGGCACCGACATA
TCGCCTATCCAGTCGACGTGGGTACCGCCCAATCTAAAATTGTAAGCACCTTCTTTCCAACCCCTCAACACGAAAAACAC
ATGTTATCACCTTTTACACAGCTTACAACTATAATACAGTGAAATCGAAGACTACACAAGCCCATGGTCATATTCAGACG
GGACCTTTGACTATGTGCATATGCGCTACCTTGAAGGAACTATCAAAGACTGGACTGGAGTGGCTAAAGAGGCATACAAG
TCTCTGAAGCCTGGTGGATGGATTGAGAGTTCTGAAGCCTCTGCAAACTTTGTCTCTGATGATGATTCTATTCCCCCAAA
CTCAGCTATGGCCCAGTGGGGCCCTATTTTTTGGAAGGGTGGCGAGCAGAGTGGCCGGTCGTTCCGCATATATGAAGACG
ACATACAAGCGAAGTGTTTGAAAGCCGCTGGCTTTGTTGATCTACACGTGAAGGAATTTAAGGTATCGTCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62