GenePrediction:GLEAN_5466 Details

Name: GLEAN_5466
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:449179..448007 (- strand)
Length: 1173
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:449179..448256 (- strand)
Length: 924
Type: CDS
Source: GLEAN
Position: GCSC_132:448192..448007 (- strand)
Length: 186
>GLEAN_5466 class=GenePrediction position=GCSC_132:449179..448007 (- strand)
ATGCCGTCCGCCACAAGCGCAATTCCGGCGACGCAGCGCGCCGCTGTCAAGGAAGGCCACGGTGCCTCGGCCAAAACGCC
ACTGCGCGAGGTAGCCGTGCCGCAGCCGGGCCCAGACGAGATCCTGGTCAAGCTGACGTGGACGGGCCTGTGTGCGAGCG
ACAAGTCGCTGCTGCACGACGAATGGGGTGGCGTCGGCCTGGCCATGACACCCGACACCCACGGCATCGCCGGCCATGAG
GGTGTCGGCCGGGTCGTGGCCATGGGTCCGGGCGTCGAGGCCGCCGGCCGCTGGAAGCTGGGTGACCGTGCCGGCATCAA
GTGGATCGCCAGCGTGTGCGGCCACTGCGTCTTCTGTCGCGACTCCTACCAGGGTGGTGAGGTGCTCTGCCTGCACCAGA
AGAATTCCGGTTTCTCTGTCGCCGGCACCTTCCAGCAGTACTGCGTCACCTCGGCCGCCTACGCGACCGTCCTGCCAGAC
GCCGTCTCCGATGAGGAGGCTGGCCCCATCATGTGTGGTGGCGTCACGGCCTACTCCGCCTGTAAGCGCAGCCAGGTCCG
TCCTGGACAGTGGATCGTCCTTCTCGGCGCTGGCGGCGGCCTCGGCCATCTCGGCCTCCAGTACGCCAAGGCCATGGGCA
TGCGCATCATCGCCGTCGACGGCGGCGCTGCCAAGCGCGAGATCTGCCTCCGCATGGGCGCAGAGATCTTCCTTGACTTC
GCCGACACCCCCGACATGCCTGCCGCTGTCCTCGCTCTCACCGACGGCATCGGCGCCCACGGCGTCATCAACTTTGCCGC
CGCTCCCTCCGGATATGCAACCGCCCCTTATCTGCTGCGCAGCAACGGTACCCTCGTCGCTGTCGGCATGCCCGGTGACC
CGGCCGTGCTTGCTGGTGCCCCGCCCATGATGTTGGCTATCAAGGTATGCTGTTATCCGAGTCTTAATCTTTGCCCTGTT
TGCTTAGTAAGCTGATCCTCTGCCCAGAGACTCAATATTGTCGGCAGCGCCGTGGGCACCCTTGCCGACGTGGACGAAGC
CCTCGACTTCACCGCACGTGGCCTGGTCCACCCAATCCTAACCAAGGGCACTCTGGCCGACGTCGACAGACTTATGGACG
ACATGGTGTCTGGAAAACTTGCCGGGCGGGCAGTGCTGAAAATTGAGGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62