GenePrediction:GLEAN_5467 Details

Name: GLEAN_5467
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:426080..424463 (- strand)
Length: 1618
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:426080..426003 (- strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_132:425928..425092 (- strand)
Length: 837
Type: CDS
Source: GLEAN
Position: GCSC_132:425041..424463 (- strand)
Length: 579
>GLEAN_5467 class=GenePrediction position=GCSC_132:426080..424463 (- strand)
ATGGCTGTGAACGACTATCTGGGAAAGTCCAACCGGACGTTGATCCTGCTGCTATGGTGTTCGAGCATCATGTCGACGGT
AAGAACAGTCTCGAGGCGCGGGACCGAGCAGATGGGCGATGTGGGTTTTGGCTGCTGACCTAATGGCAACAGTCGCTCGG
GTTCGACGCCAGCATGATGAACAGCCTTAACATCCTGCCGTCGTACACAGACTATTTTAAGCTGGACACGGCGACGCTGG
CGCTACAGTCGGCCATCTCGTGGGCCGGCATGTGTGTGGCCAGCTTCTTCTACGGCACCCTGACGGACTACTACGGCCGC
AAGAAAGCCATGTGGCTCAGCGCCATCATCACGCTCGTCGGCGTCGTCATCCAGGCCGCGGCCCAGGACATCGCCATGTT
CGTCGTGGCCCGCTTCATCGTTGGCCTCGGCAACGGCGCGACGTACGTGTGCGGTCCCATCTACCTAGCCGAGTGCTTCC
CAACGCGATGGCGTGGTCCTGGCCTGGCCCTGTTCACCGACATGTACTATGTCGGCAGCCTGATCGCGGCCGGTGTGACG
TATGGCACGGCCAAGATCCTCAACACATGGGCATGGCGCACGCCTTCCATTCTGCAGGGCTTCCTTATGGTGCTCGCTGT
TGTGGCCTTGCCCTGGATGCCTGAATCTCCCCGCTGGCTTATCCACAAAGACCGCCACGAGGAGGCTCTCGATGCCCTGG
CGGACACTCACGGAAACGGCAATCGCGACGATCCTCACGTGACAGAGACATACAACGAGATCGTCAGCATGCTGCAGGCC
GAGATCGACCTTGGAAAGGAGGTTGGCTTCAAGGAGATTGTCAAGTCGCGGTCTAACGGCATGCGCATACTGCTGTGCTG
CTCTGTCGCCGTCATTTCCATGCTGTCGGGCAACAACATCATCAGCTACTACCTTGGCCAGATGCTGGACCAGGCCGGCA
TTACTGACAGCACAACGCAGCTTGAAATTGTAGGTTTCCGTCCACCTTTATTACCTAACTTGTTGCTAACCTGCCATAGA
ACATCGTCCTTAGTTTGTGGTGCCTTGTTGTCGCTCTGGTCGGCACGTACACTCTAGACAACGTCGGCCGCAAGCCATTA
GCCATCTACTCGTCCATCGCCCTCACCATCTTAATCTTTGTCTTTGGCGCTCTTACCAAGACATATGGCAACTCGACACA
AACCTCGGGCATCTACGGCACCGTTGCGGTGCTCTTCCTCTTCCAGGGCGCCTACAGCTTTGCCTGGACCCCCCTGGCGA
TGTTGTATCCGCCCGAGATTCTCAATTTTTCCATCCGGTCGTCGGGCATGGCCGTCTACACGTTCCTGTCCAACGGCCTG
GGCCTGATGGTCACCATGGCCTTTCCATATGCGCTTGCCAAGATCGGTTGGAAGACATACATGATCAACGGCGCCTGGGA
CGTGCTGCAGGTGCTGTTTGTCATATATTTCTGGGTGGAGACGAAGGACAAGTCACTTGAGAACATCAATGAGATCTTTG
AGGGTCCAGCGGCCACAAAGGTGCTCGAAGGCGAGGACGTCGCCTACCCGTCGTCGCCGGTCTACAAGAGCGAGAAGGGT
GCGACGGTGACTGTATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62