GenePrediction:GLEAN_5468 Details

Name: GLEAN_5468
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:423828..421203 (- strand)
Length: 2626
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:423828..423775 (- strand)
Length: 54
Type: CDS
Source: GLEAN
Position: GCSC_132:423722..422633 (- strand)
Length: 1090
Type: CDS
Source: GLEAN
Position: GCSC_132:422569..421203 (- strand)
Length: 1367
>GLEAN_5468 class=GenePrediction position=GCSC_132:423828..421203 (- strand)
ATGTCGTCTACTGATGTAAACGCCGTTTTGGCGAAGCTGACGCTTGAGGAGAAGGTTGGACGACCAATGACTACAGAAGA
GGTCGACTGTTGCTGACTCACGGCAGATCTCACTGCTTGCCGGTGCCAACTTCTGGGAAACTGTGCCGATTGCATCCAAG
GGCGTGCCGGCCCTGAAGGTTTCAGATGGCCCGAACGGCGCCCGTGGCGGGACATTCTCGGGCGGCGTGACGTCGGCCTG
CTTTCCGGCGGCCTGCAGCGTGGCCTCGACGTTTGACGTGGACATTGCGCGGCGAATCGGCGTGGCGCTGGGCGAGGAGA
CGCACACCAAGGGCGCGCGGGTGCTGCTGGCGCCGACGGTCTGCATACACCGACATCCGCTGGGCGGGCGCAATTTTGAG
AGCTTTTCAGAGGACCCCTTCCTGGCCGGCAAGCTGGCCGCACGGGTGATTGAGGGAGTGCAGTCGGAGGGCGTGTCGGC
GACAATCAAGCACTTTGTGGCCAACGAACAGGAGACGCGGCGTCTGAGTGTCAACACGATTGTGGGCGAGCGAGCGCTGC
GTGAGATCTACCTGAAGCCGTTTGAGATAGCGATCAAGGAGGCGAAGCCCGGGGCCGTGATGACATCGTACAACCTGATC
AACGGCACGCACGCAGACTCGAGTCCGTTGCTGAAGGATGTGCTGCGCGGAGACTGGGGCTGGGATGGACTGGTGATGAG
CGACTGGGGCGGCGTGAACTCGACGTTGGAGGCGCTCGAGGCCGGCACCGATCTTGAAATGCCGGGGCCGACGCAATGGC
GCAAGATCGAGGCCGTGGCCGCGGCCGTTCGCGACGGCCGGCTGTCGTCGCAGACAATCGACGAGCGGGCGCTTCGGGTT
CTGCGCTTTCTCCAGCGACAGGACTGCTTCGAGGACGCCACGATTTCCGAGGAGAAGGCAGTTGACCGGCCAGAACACCG
GGCGCTCATCCGCGAGGCTGGCGGCAAGGGCATCGTCCTGCTCAAGAACGAGGGAGCTGTTCTGCCGCTGAGCAAGGACC
GGCTCAAGGGAAGGAAGGTAGCTATTTTGGGCTATGCTGACGAGTGTCTGGCCCACGGAGGCGGCAGTGCAGCGGTGAAC
GCACACTACAAGAGTACACCTTTGGATGCTCTGCGGGAGGCTCTAGGGGAGGATGTTGAGGTGACTTATGCCAAGGGTAA
GTGAGGTGGTGATGGTAGAGGCAGCGTTCACGATGATGATACACTTCTAATGGAAACAGGCGCCCCAACCTTCCGTCAGC
TACCCCTCCTGACTGATAATGTCGTCGGCCTCGACGGCTCGCACGGCTTCACATACCTGATCTACAGCCCGGGCAACCCT
ACACCAGTCAAGACGATCCACGGCCACGGCCAGTCCGAGGTCTCGCTGATCCAGCCAGTCTACCACGACGCCAACGAGGC
CGAGCTCGTCGGAACCTTTACGGCCCCCGAAACCGGCACCTACTACCTCACGCTCTCTGGCATGGGCCCGTCGCAGCTGT
TGATCGACGGCCAGATCGTCTACGACCAGCCAGCCAACTGCCCCGACTTTATGGGCTTTCTGCTCGGTGGCGTGGCCGTG
CCGTTTGTCCCGTTCCAGCTACAGGCCGGCACCCAGTACAAGCTGCAGATCCGAAGTAGGCCACCGACGCCGGACGAGGG
CGCCGACATCATCCCTATCTTCCAGCATCAGCCGGGTGTTCGTCTGGGCCTGATGACGGCTGCTGTCCACGACCAGGATC
TGCTGCCTGAGGCGGTCGAGCTGGCCAAGGCAGCCGACGTGGCCATCGTCTTCACCGGCCACGCGGCCGAGTGGGAGACC
GAGGGCCAGGACCAGGCCAGCTTCCACCTGCCCAAGAACGGCAGCCAGGACCGGCTCGTGGCCGCTGTGGCTGCTGTCAA
CAGCCAGACGGTCGTCGTCAACTCGACCGGCGTCGCTGTCGCCATGCCGTGGCTTGACCAGGTTCAGGCCCTCGTGCAGT
CCTGGTTTCCCGGTCAAGAGGCTGGCCACTCCATTGCCGATGTTTTGGTCGGCGCTCGCAACCCTGAGGGCCACCTGACC
TGCACTTTTCCCCGCCAGATCGAAGACAGCCCGGCCTACGGCAACTTTCCCGGCACGTACGACGATCAGAACAGGCTGAC
GGTCACGTATGCTGAGGGCGTCTTTGTCGGCTATCGCCACTACGATCGCCTGGCCGCTGACAAGGTCAACTTTCCTTTTG
GCTTCGGCCTCTCCTACACGGCCTTTTCATACGTCGAACTGGCCGTCAGCCCGGTCTCGCCCGACGAGTACAATGTCCGG
GTCACCGTGGCCAACACGGGCGCCGTCCAGGGCGCAACGGCCGTGCAGATCTACGTCGGTGGTACCGTGGCTTCGGCCGA
GACCCCGGTCAAGACCCTGGCCAGCTTCAAGAAGATCACCCTGCAGGCGGGCGAGAGCACCGTCGTCGAGCTGCCCGTCA
AGCTGCAGGATGTGGCCTCGTGGGACGAGAAGACTCATAGGTGGTCCATCCAGGCCGGAGACTACAAGTTCAGCGTTGGC
AAGAATGCCCGCGACATGGTGCTGTCAGTGGACGTGCATCTCGAAGCAAAGACGTATCTGCCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62