GenePrediction:GLEAN_5470 Details

Name: GLEAN_5470
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:410023..409240 (- strand)
Length: 784
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:410023..409761 (- strand)
Length: 263
Type: CDS
Source: GLEAN
Position: GCSC_132:409684..409240 (- strand)
Length: 445
>GLEAN_5470 class=GenePrediction position=GCSC_132:410023..409240 (- strand)
ATGGCGCCGAACGATAACCGCCCCGATGCTGTGCCCGTCAAGGATGAAGCAGACCTTGTCATGTTTGCGCAGGTGATTTC
GGTCTCTTTTTCCGACGACCCGCTCCATCGATACGTCCTCATGGGTAGCGAGTCTCATCCGGGCCATCCAAAATTGCACA
CGCCGGGTTTTCAGGAAGAGAACTGGTTGGCGACGATGAGATCGCGGTTTGAGGGGGGCGGACTTCTGCTCCAGAGCTAT
AACTGGGCGGCTGTCGCGGTGTGGTGAGTGACTCTAGTTGTGAAATGAATCACGATAACGCTTAGAGGAACACTCCTTCA
TATTCTTATCTCGTACCAGGCTACCGCCGGGTATTAAGAAAGCTGCACCCCGTCTGCCCATTCCAGAGGGAGCTGTTGAG
TACCTGGATAAATTTGGCCAGATTAAAAAGCAATATCTTGGCGATCGACTGCACTGGTATCTCAATCTGATAGCACGCGC
TCCAGGCCGCTTAGACAAAGGTAATTACATCCACACTCTTTCCCGCCCAAACAACTTTCTCATGCATCTGAGCTTCTCAG
GTGCCATCAGGACTCTCATCGAGCCATATGTGAGAAAGGCCCTAGAGGAAGGGTTTCCGGTCTACTTGGAGGCCACCAGT
ACGCATGCTAGAGACATCTACATCTACTTTGGCTTTAGGGTCCTAGAGGAAGTTAGGATAGGCGAGGGTATAATCAATGC
TGAAGGCTGGGTAGAGCAGGGTGGAGAGGGTGTGCTGCTCTGGGCAATGGCTGCCGGCTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62