GenePrediction:GLEAN_5473 Details

Name: GLEAN_5473
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:400492..399031 (- strand)
Length: 1462
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:400492..400316 (- strand)
Length: 177
Type: CDS
Source: GLEAN
Position: GCSC_132:400245..399981 (- strand)
Length: 265
Type: CDS
Source: GLEAN
Position: GCSC_132:399913..399803 (- strand)
Length: 111
Type: CDS
Source: GLEAN
Position: GCSC_132:399733..399616 (- strand)
Length: 118
Type: CDS
Source: GLEAN
Position: GCSC_132:399556..399464 (- strand)
Length: 93
Type: CDS
Source: GLEAN
Position: GCSC_132:399406..399031 (- strand)
Length: 376
>GLEAN_5473 class=GenePrediction position=GCSC_132:400492..399031 (- strand)
ATGGCGGACATGACCGCATCCACTTATCGGCCTGACTACAACAGAGGCCCCCAGATCCTCATTGTTTGCGGGACGCTGGT
CGGCGTCTCTGTCGTCATGGTCAGTCTTCGGATCTGGGTGCGAGCCACGATGATTGGACATGTCGGCCGCGACGACTACT
GCATGGTTGCGGCTGTGGTATGTACAGAAGCTCCTTGCCGCAACACAAGGAGAACCAACAGACGCTGACACGCATTTTGC
GACACAGGCCGTCCTCTTTACCGAACTGATGGTCATCATCCCCGAAGTCAAGCTGGGCGGCGGCAGGCACAAGGAGTATA
TTCATCCGCCCGAGAATATCGTGAGGGGCTTGCACCTCAACTTTGTCACACAGCCTTTGTGCCTGCTTGGCTTGCTGCTG
ACCAAAGTCAGCGTTGGGTTCTTCCTCCTGCGAATGACCCCCACGACTGCTTTCCGCCGCTTTATCAAGGGAACAATCGT
CTTCACTAGTCTCTCGGCCACTGGAAACTTGTGTACGTCGGCACCGCATCCAAATGTCGCCCAGGGATCACGACTATCCG
ACTGCTAACTACGTGGCAGTAACGGTCTTCTTCCAGTGCAGACCGCTGGCGTTTACATGGGACGCCTCAGTCGCTGGGGG
GTCATGCATCCCGTCTGGCAATCTGAAATTTGCTGCTTTCTTCAACTCGAGTATGTCGATGTGCAGTCGTTACACTTATC
ACAGCACGAAGTTGGCTAACAAGGGCTGCCAATAAACAGGCGTCTCCGTTCTCACCGATCTCATATTTGCGCTACTTCCG
ATCCCAATGCTATGGAAGGTCCGACTGAACTGGAAGACCAAGGCAGCCGTTGCCGCAATTCTGTCCCTCGGCATCTTGTA
AGTACTCGATCGTGTCGCCGTCCGGCCAGTCTTCGATGGCCAACTAACTGGTGCAGTGCGACTATCGCAGGCATTGTCAA
AATCACATTTCTCGGAAGCTACGGCAAACACGGCGACTTCTTGTTTGATAGTGTGGATATTACAATTTGGTACGCAAGAA
TGAGGGCTAATTTCCTGCATAATAAGTACTAACTTTCGTACTAAAGGACCACTGTCGAGATCTGTGCAGCAATGGTGGCT
GGGTGCTTCCCGGCGCTCAAGCCGATGTTCAAGACCATTTTAGCAGGCAGGAGCAGTAACAAATCGTCGCGGGAGACATA
CGCACGCGATGGATACATTCGCAACATTGGCGCCAGCGGTGCGAGCGGTGCCAGACGCACCTTCAAGTCGCACTGCGACG
ACAACGACTTCGAGTTGTTTAGCCGGCAAGGCAACGAAACCGTCACCGTCGGCGGACGCATGGGCTCGACCGAGAGCATT
CTTCAGACTGAAACTCCGGTTGGCGATGGCATCACTAAGACCACACAGGTAGTTGTTACAGTGGACGAGCAGCAGGAAAA
GAGCGTCAAGAACCTTGTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62