GenePrediction:GLEAN_5477 Details

Name: GLEAN_5477
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:383259..378994 (- strand)
Length: 4266
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:383259..383063 (- strand)
Length: 197
Type: CDS
Source: GLEAN
Position: GCSC_132:382797..382674 (- strand)
Length: 124
Type: CDS
Source: GLEAN
Position: GCSC_132:382550..382256 (- strand)
Length: 295
Type: CDS
Source: GLEAN
Position: GCSC_132:382182..381884 (- strand)
Length: 299
Type: CDS
Source: GLEAN
Position: GCSC_132:381830..381387 (- strand)
Length: 444
Type: CDS
Source: GLEAN
Position: GCSC_132:381329..381079 (- strand)
Length: 251
Type: CDS
Source: GLEAN
Position: GCSC_132:381018..380530 (- strand)
Length: 489
Type: CDS
Source: GLEAN
Position: GCSC_132:380144..379913 (- strand)
Length: 232
Type: CDS
Source: GLEAN
Position: GCSC_132:379846..379234 (- strand)
Length: 613
Type: CDS
Source: GLEAN
Position: GCSC_132:379181..378994 (- strand)
Length: 188
>GLEAN_5477 class=GenePrediction position=GCSC_132:383259..378994 (- strand)
ATGCACAACGCCTTATACAACGGCACCTACAGACCTGAATTCTATATCAAAATAATCATGGACGATGCGGCCGCAGAGAC
CGACCATGTCGGCGGGTGCCCTAACTCACCGGGATGCTCAATGACGGCACGACGAGCTGTCAGTTTCTGGAATGACTTCA
TCCCGGGGTACAACGGCCCAACAGCTAACAACGTGTTGTAGTGTGACGCCTGTCGTGCTCGAAAGGTATGCGATCGGCTA
GAATACCCGGATTAGGCTTCTTACGGGCAGGCTGGCTGACCTGTAGAAGATTCGATGCAATCGTGGACAACCCTGTTCGC
ACTGTATTCAGGCCGGCATATCGTGCACGAACGAGCCCAAACCGAGAGAAAAGCGAGCGCGCATTCTTCTCACGAGACAA
TAGTGTGTCTCACTCATTCGTTTCAATCTCCTTTGCCGCCTGAATACTCACGATCGGCCCAGTGAACAAAAGATTGACCA
CCTTGAAGAACGCCTGGATGTGGCCATCGGCCTGCTCGAGCAGCTGACCAAGACAATGTCAAGCCAAAGCAGCACAGTCC
AGATTGCATCTCCAGGAGCTCTGAACGTTCCTGTGCTCTGACCATCAGAGCGGCCGATACACTTCTCCACGCTGCCACAC
GCAGCAGCAGAACATCATGCGCCATGTGCCACACCCGCTGCACTTGGCCCGACCGACAAAAACCTGCAGCATGACACGGA
TGGTGCGACCGTGGTGGAGGGAGACTCATCTCTCGGCGCACACTCAGCTTTTGCAAGCAACTTCGTCAACAGCTTCATCA
CCAGTGGGTCCCCTGCAGCGCCCAGCCTGGACATGCGGCAGACCCTTGACGTCCTGTCTCGCATCGTCACAACTCTAAAG
AGGCCCAAGGCGGCAAGTGAAATGACGTACCCCCTCAGCCTTGAACCTCGTGTGCAGCTTCCAAAACGTGATCGGCTTCC
GCCCATCGACAGGGCCATGGCGCTAGTCAGTGGCGCCTGTAATGGTAATGCCAGGAAGATGTTCCATTCTACACCGAAGA
TGAGATAATAACTAGAAACCTGACTGAGTGTTTACAGAAACACACAAGCATCTCCATCTGACGATGCAGTGCTACAATGC
ATTGACGATGAATGACTTTCCCCTCATGTGCCACCACGCATACTTCTCACCGACGCCGTCTGAATACGACTATATTGTCG
TGTTATCTGGACTGTCTGCGTTATTCTGGATGCATGCTCACACCGTTTCGGCCGAAGAGAAAGAGGAGTATCTCCGATAC
GATCACATGTGCCACGTTCATCTCGAGACAGCCCTGTCCAGCCTGCCGCTGCATCTTCCTGCGCGACCTGACGTTATCGC
GGCACTGCTGATGGGGGTAAGATGCACCCCGGTCTTTTCGAGAGACTTAGGATGCTGACCGGGCTGCAGACTTACTATGC
CATTGAGATTTCAAAGCCGTCTCTGTCGTGGATCCTCACGTGCAAAGCATCTGAGCTGTGCCAGACTCTAGGCTACAACA
ACGCGGCAACGATGCACGAAGATGCACCTGAAAAGGTCCAGCATAAGCTGATTTTATTCTGGGCTACTTACAACCTCGAG
AAGTCTCTCTCTCTTCGCCTTGGCAGACCATCTACGATACCGCAGTGGAGCATCACGGTTCCAATACCGTCTTCCATCAC
AGGTTCTGGCGAAGAGTCCTGGGGTTTTGCGTATTTTGTCTTATACATTGAGGCTGCTCGCTGCCAGGGTGACATTTACG
AGATGCTGTACAGTCCCGACGCCGTAACCCGGCCTGCAGATGTTAGGCAAGACCGGGTGCAATATCTTGCAACCGAGATA
CAGCGCCTCGAAGTAAACTCGCAGAAATTCAATGTAAGCTTTCCCTGGTGTCTAGGTGAAAGAACAATGAACGGAACTGA
CAATCGCCAGGAAAAATGGTATGCGATTGTCAGCGCAGCCATTGGGAAAGACATCCTAGACTTTAATAACTATTCCGACG
AAGTTCTCCGGTCATCCTTGCTCACCCTGATCTACCGAGCTGATCCTCGACCGATCGGCTCTTTGACGACGTTTAGCGCC
GAGTGCCTTCATGCTGCCCGGACGACCCTGAAGCGTCACCAGCTCTGCATGTCTGTGGTAGGAAAGAATCAAGAAATGTT
TTTTCCTTTATATGTCTACTGGTAGGTGGCCAAGGAGCGTGGTAAATTGTCATTCGCCGTCTGCTAAGACCATCAACACA
GGATACTCCTCTTTTCACCGTTCATTCCGTTCATCGTTCTGTTCTGCCAGGTGATCGAGACACAGGACGAGTCTGACTTG
GTTCAGATGCAGGCCTTTGTCTACTCCATTCAGTCGGCGACTGCACTCAGCTCTGAGGCGGGAAAAATGCACCTCCTCTT
CCAGGCACTCTACAATGTAGCGTCCCACTACGTCGAGATGAGCCGGACCCAGATGCAGGCGGGACAGGGCCTCGACTACA
CGCAAGCGAGCGTCCAGATGAACGACTACCTAGCTGCATTGGGCTTCTCGAACATGGCTTCTCGTGTCGGTGGATCGGAC
GCGCAGCCCGCTGAAGAACAACCTGTCCCGGGCGACCATACCTCCACTGTTGGCTCGGTTCCTCCGCAGGATGGTGGAGA
GATGGGGTGGATGATGGGCGGCTGGCTGCACGACAACCAGGCCATGGTGGAGCTGATGCAGTTTTCCGACTACATCGCGG
AGAAGCAGAGGTGATGTCACAACTGGAGCCTCCAGTGTTGCCAAAACAGCAGCGCCTCATATCCACTGAGAAATCCGGTT
GGCTGTGTTGTATCGATGGCGCCAAACTGAGGAAAAATAAGGTCTTATCGTACATGACGTTATCTTGACGATCGATTGCG
GCAATCGTCAACCGGCTATTACAACCCTTACAACGTACTTGCAATACTGGAGCGGACAGTTTTTGCCCGAGCCCGCTCAA
AGTAGCTCTCCCCGTCTCTGAGTCTGTATATATATATTTTACTCGGTGACTCCTGTCTTCTTCTCTGATTATCCCTACAC
CATGAAACTGTTCTCAACGAAATGGCAGTTGGCCGCCATCCTCTTGGCGACTATCGCGACAAGTACCGTTTCTAGAACCG
TACCGACATTCGAGAGTGACCAGAAGCCTCTCCGTTCTGGCAAGCCATCTCTTGCACCCTTCTCTTCCGCCTCTCTCGTC
GAGCTGCACAAATCGCTGGTGGAAATTTCGTCCATCACCAGGACCGAGGGCGACGTGGCCGCCTTTCTGCAGCCCTACTT
GGAGGCTCATGGCTTCACGGTTGAGCTGCAACCCATCACAGCCGGCCGCTACAACGTGCTTGCCTACGTGGGTGACCAGC
GGCAGACGCGCGTGCTCGTGACGTCGCACATCGACACGGTCCCACCTTTTTAGCTCTACGAGCGCCGTGGAAACACCGTC
TGGGGCCGCGGCACGGTGGATGACAAGGGCAGCGTGGCCTCGCAGGTGGTGTCCGTGTCAGCGCTGATCGCAGCCGGACG
AATCACCGAGGGTGATGTGGCGCTGTTGCTGGATGTCGGCGAGGAAAAGGGTGGCGACGGGATCCGGGCGGCCAACGAGC
TTGGCCTCTCTTGGGAGGCCGCCGTATTTGGCGAACCGACTGAGCTGAAGCTGGCCGCCGGCCATAAGGGCGGACTTGGC
TTCAATCTCACGGCCAAAGGCATCGCCGGCCATTCGGGCTACCCAGAGTTGGGCATCAACGCTATCAACCTACTCGTGCG
CGGCCTCGCCGCCCTTGAGGCCCTCGAATTGCCCGGGAGTGCCCGCTTCGGAAACTCGACGCTCAACGTGGGCACCATTG
GCGGCGGCGTGGCTGCCAACGTGATCCCTGAGGACGCCTACGCAACCGTGTCGGTGCGCGTAGCCGTTGAGGCTCCAGAG
GTTCTCAGAAGGCTTATCGAAGCGGCTATGCTCGCGGCCGTGCCTGAGCTGCAGCTGGACTTTCGCTATGGCGTCGGGCC
AGTGGCCATCGACCACGACATTGACGGTAGGGACAACGCACGTTCATGAAAGGATGTTCGATCGGCTGACTCGCTTAGGG
TTTGAAAGTATCATCCTCAACTACGGAACAGACATCCCGGGACTTTATGGTGACCACAAGCGATATCTATACGGCTCGGG
AACCATTCTGTACGCACATTCGGACCAGGAGCACATTAGGATATCGGAACTGGAGGAGGCCGTCAGAGGGTACCAAACTA
TCATTACAGAGCTCTTGAGCCGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62