GenePrediction:GLEAN_5478 Details

Name: GLEAN_5478
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:375070..371938 (- strand)
Length: 3133
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:375070..373422 (- strand)
Length: 1649
Type: CDS
Source: GLEAN
Position: GCSC_132:373275..373059 (- strand)
Length: 217
Type: CDS
Source: GLEAN
Position: GCSC_132:373003..372306 (- strand)
Length: 698
Type: CDS
Source: GLEAN
Position: GCSC_132:372250..371938 (- strand)
Length: 313
>GLEAN_5478 class=GenePrediction position=GCSC_132:375070..371938 (- strand)
ATGGGCCGACGATATAAAGGGCTGGACTACCGGCGGCTGGCTTCGTCGCCTCCTCCCGACAGCGATGCAGCCCCCTCTTC
AGCCTCTTCAGCCTCTTCAACGGCAGCAATGGCGCAACCAGAAGAGCAGCGAGCAGACGAGGTGCTGGTGATGGACGAGG
CAACGGCCAAGCAGGTGGTGCGGCGGATTGACTGGGTTCTGATCCCGCTTCTGTTCACGACGTACATGCTGAGCTTCATG
GACAAGACGATCCTGTCGAGCGCATCGGTCTTTGGGCTGCGCGAGGACAACCACCTGACGACGGAACAATACAGCTGGGT
GTCGTCGATATTCTACTTTGGCTATCTCGGCTGGCAGTATCCGAATGCGCTACTGGTGCCACGGCTGCCAGTGGGACGGT
ACCTGGCCGTGGTGACTCTGGTCTGGGGGGTGGTGGTGTCGCTGACGGCAGCCTGCTCGAGCTACGGTGGCCTTCTAGCG
GTGCGATTCCTGCTGGGCGTGGCAGAGGCGAGCATTACGCCGGCATTTATGTTCCTGACGACGACGTGGTACACACGCGA
TGAGATGCCGACACGGACGGGCATCTGGTTTGCGGGCAACTCAGTCGGCGGCATGGTGGCGTCGCTGCTGGCCTTTGGCG
TTGGCCACATCAGCGAGGACAACGTCGTGGGGCCGTGGCGCAGCACGTATCTCATCCTGGGGCTGGCGACGTTTGTGTGG
GCGTTTGTGCTGGGCGGCCTGCTGCCGGCCTTTGGCAACATTGCGACGGCGCCGCGTTGGCTGCTGCGCACACTGGCCGA
GCGGCAGTTTGCGGCAGCACGCGTCGTGGTCGCTGGCACCGGAAACACGGCACAGACGCGCTGGCAGCGCGCGCAGCTGG
TCGAGTGTCTGGTCGACCCCAAGACCTGGCTGCTGTTCGCGCTGCAGCTGCTGACTCAGATTCCAAACGGCGGGACCCAG
AATTTTGCCAACTTAGTCATCAAGTCCTTTGGCTTCACCAGCCTGCAGAGCACGCTCATCAACATCCCGTACTCGCTGCT
CTCAGCCGCGGCCATTTCCGGATCGGGCTGGCTTGCCGGACGGTACCGCCAGGTCAACTGCCTGCTCATCATCGCCGTCG
TGCTGCCCTGCATCGTCGGCAGCGCCCTCATCTACACGCGCAACCACCACCACAACAAGGGCGCCCAGCTGTTTGGCTAC
TTTCTGCTCTGCACCGGCTCCTCGGCCATGCCGCTCGGCCTCTCGCTCGTCCAGGCCAACACCCGTGGCGTCACCAAGAA
GATGACCACTACCGCCCTGCTCATGCTGGCCTACTGTGCCGGCAACATTGCCGGACCTCACTTCTTCAAGGCCGCAGAGA
AGCCGACATACAACACCGCCTTCCGCGCCATTCTCGTCTGTTATTGTCTCGCCATGCTGACGGCTGTCTGCCTGCGCGGC
TACCTGCAGTGGGAGAATGCGCGGCGGACCCGCCGCGAGGGCTTTGTCGGCAGCTCTGGCACCGCTGGCATTGTCGGCGT
CGGTGGAAAGACGATCGATGTCGACGGCGTCAACAAGAACGCGACTGCGGCCGTCAGCGGCGTCGAGCTGCAGTCGGCTG
ACTACGAGGACGTAACCGACTGGGAGATTGCCGGTTTCCGGTATCGGTTGTAGGTGGAACTAAGAGTTCTGACTGTATTG
TCGAGTTAGAGTGTATCGTCGTTCCAATTGAATTGTCGTGCTGAAGTATTTATGCTCGCTTTGGACTGTTGTGTTTTTGT
TCTCTGAGAGTACACAACCACATCACGATACCTAGACTATGCCTATTCCCGCAGTCGTCAGGCCACTTCAACCCCGCACT
AATCCGGCTGCTGTCGTCTTGTTCTCAGCTCTCAACTCTTGCCTTCACATACAACACCACATCTGGTCTCGCCTCAAGTA
CAATCACAATGAGAGCCGCACGCTACTACGGAAAGGAGGATATCCGCATTGAGCAGGTTCCCGAGCCGTCTATCCGGCCA
GGGCAGATCAAGGTAGCAGCGTCTTTCTTCTGGCTGTTGTCCTTCCGACGCTGACACTGCTTCACAGATTGCCCCTGCCT
TTGTCGGCATCTGCGGCACCGACCTGCACGAGTTTCTCGGCGGTCCCAACTTCTGCCCGGAGAAGCCGCACGGAGTCACG
GGCGAGACCATTCCCGTCACTCTCGGCCACGAATTTTCGGGCGTCATCACCGAGATTGGCCCCAACATCGACCCAGCCAG
CATCGGTGACCGCCACTTCGAGGTCGGCCAGCGTGTGGCCGTGCAGCCAACCATCTTCTGTGGCCATTGTGCTGCCTGTG
CCACCGGTGCGGCCAATGTCTGCCACGACGGCGGTTTCGTCGGCCTCAGTGGCGGTGGTGGCGGGCTCAGCGAAGCCGTC
TGCGTGTCCGCCACCCACGTCTTCCCGCTTCCAGACAATCTGAGCCTCGAGGAGGGCGCCCTGGTCGAGCCGCTCTCAGT
GTCCTGGCACGCCGTTTCAGCTGCTCCCGAGATCGGCCCAGAGTCTGTCGTTCTGGTCCTCGGCGGCGGCCCCATCGGCC
TCGCCGCCGTCCTCTGTCTCAAAGCAAAAGGTGTCAAGACGATTGTCGTGTCTGAGATTGCGGCCACACGCCAGGCCTTT
GCCGCGCAGTTTGGAGCCGACCGCATTGTGAACCCGATCGAGGAAGACGTCGTGCAGGTGGTGCTGGCCCTGAGCGAGGG
CAGAGGTGCCGACGCCGTCTTTGATTGTGCTGGGGTCCCTGCAAGGTAATCATTCGTGAATGGCCCTCTGTTTTCAGGCT
TGCAAAACTGACACCGATAGCATCAAGAGTGCCTGCGAGGCCGTCAAGACTAAAGGCACCGTAGTCAACGTGGCCATTTG
GGAGAAGCCGATCCTGTTCAATCCCAACTGGATCACCTTCAAGGAGAGCTCCTACAAGTCTGTTCTCGGGTACCAGCCCG
AGGACTTCAGGGCCGTGATCGAGAATCTCCGTACAGGTTCCATCAAGGCCCGTGGCATGATTACTGGCAAGATTAGGCTC
GAGAATCTTGTGCAAGAGGGCATCAAGAGGCTTATCGAGGACAAAGATAATCAAGTCAAGATCTTGGTTGACGTCAATGC
GGTAGCGTCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62