GenePrediction:GLEAN_5479 Details

Name: GLEAN_5479
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:370181..366904 (- strand)
Length: 3278
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:370181..370159 (- strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_132:370102..369962 (- strand)
Length: 141
Type: CDS
Source: GLEAN
Position: GCSC_132:369908..369436 (- strand)
Length: 473
Type: CDS
Source: GLEAN
Position: GCSC_132:369374..366904 (- strand)
Length: 2471
>GLEAN_5479 class=GenePrediction position=GCSC_132:370181..366904 (- strand)
ATGACGACCCAAGGCCATGCAAAGTATGCCGGTCCCCGGCGCTCGTTGTCAATGCACAGCTGACACCTTCTTTGCCTAGG
TCGGACCGGGAGCTCGCTGTCAACATCCAAAAGGCGACCAACTCGGACGAGACAGCTCCCAAACGCAAGCATGTCCGCAG
CTGCATCGTCTACACATGGGACAACAAGTCATCCATCGCGTTTTGGTCGGGGATGAAAGTGTGAGTAGTGCGGCCCGACA
ATGCCAGTCCTGACAGCTGATTTACCGAGGCAGCCAACCGGTCATGGCCGACGAAGTGCAGACATTCAAGGCGCTCATCA
CGGTACACAAGGTGCTGCAAGAGGGCCACCCAATCACGCTGAAGGAGGCGATGGCGAACCGGTCGTGGATCGAGTCTTTG
AGCCGCGGGGCCGAGGGTATGCGCGGATACGGGCCTCTGATCTACGAGTACGTGCGGTACCTCCTGGCAAAGCTCGCCTT
CCACCACGAGCACCCCAACTTCAACGGGACATTTGAATACGAGGAGTACCTCTCTCTGAAGCTGATTAACGATCCGAACG
AGGGCTACGAGGTCATCTCGGATCTCATGTCTCTACAAGACAAGATCGACACGTTCCAGAAGCTCATCTTTGCCCACCTG
CGGGCGACAGGCAATGAATGCCGCATCTCGGCACTGGTGCCGCTTGTGCAAGAAAGCTATGGGCTGTACAAGTTTGTGAC
AAGCATGCTTCGGGCGATGCATCAGAGTAGGTGCAGCTGCATCGAGGACAGACGTGGTACAGAGGCTGACGTTGGATTGC
GCTCTAGCGACGGGAGATGACGAGGCTCTTCAGCCGCTGCGCGAACGCTACGACGCCGAACATTACCGTCTCGTCAAGTT
TTACTACGAATGCTCGAACCTCCGGTACCTGACGTCGCTGATCACGATTCCGAAGCTTCCGGCCGACCCGCCGAACCTGC
TGGCAGACGAGGGCAGTGCACCGGCGCTTCCGGCGCGACCAAAGCAAGAGATCGAGCGGGCACCGTCGCCGGCGCAGGCA
CCAAAGTCAGACGAGCCGGATGACATGTCAGAGTTTTGGAAGACGGAGCTGGAACGGCAGAACCAGGAGTTCGCAGACCA
GCAGCGGGTGCTGGAGGAGAGGGCAGCGCAGCAGGCGCTGATGCAACAGCAGGCGGCGATGCGGGCACAACAAGAGTTTG
AGCAGCAGCAGCGCGACCTGGCGGCACAACAGCGGCGCGAGCAGGAGGCGCTGGCGGCACAACAAGCACAGTGGCAGACG
CAGGGCCAGCTGGCGGACTTGCAGCGTGAGAACCTAAACGCGCGGGCACAGTACGAGCAAGACCAGCTGCTGTTGCAGCA
GTACGACGCGCGGGTCAAGGCGCTGGAGAACGAGCTGCAGCAGCAGCAGGTGAATGCGGGGCGGCAGCATGGAGCCAAGG
ACGACCAGATTAAGGCGCTGCAGGAGCAGGTGAACACGTGGCGGTCCAAGTACGAGGCACTGGCGAAGCTGTACGCACAG
CTGCGGCACGAGCACCTGGACCTGCTGCAGAAATTCAAGCAGGTGCAGCTAAAGGCGGCGTCGGCGCAGGAGGCGGTGGA
CCGGCGTGAGAAGCTGGAGCGGGAGCTGAAGACGAAGAACCTGGAGCTGGCCGACATGATCCGCGAGCGCGACCGGGCGC
TGCACGACCGCGACCGGGTCAAGGGCTCGAGCAAGGACGACACAGAGCGGCTGAAGCGGGAGCTGCGGATGGCACAGGAC
CGGGCGGACAACCTGGAAAAGGCCAAGGGCAACGAGCTGTCGACGATGGTGTCCAAGTACCACCGCGAGCTGGCCGACCT
GGAGGAGGCATTGCGGCTGAAGACGCAGGCACTGGAAGAGGCGCGAGGCCAGGCTCGCAACGGGTCGTCGGACCTGGAGC
GGGAGCTGCGAGACAAGGAAGACGAGCTGGCCGTGTACAAGGCGGGCATGGACCAGGCGCTGGAGGAGCTGGAGGTGCTG
AAGGAGGGCCAGTCAGCGGACGTGGAGATCGACTCGCTGGTAGTCGGCAAGCTGGACGATCTGGTGGACGCCGTGTTGGA
CGCAGCAGCAACGCGGGTGGACGACTCGCTGTACGAGCTCGACTCGACGCTGCACGCAGGCAACCCGTCGGCAATGCCGC
CGTATCTGCTGTCGCAGGTGGAAAAGGCGTCGTCAGCAGCGATGGAATGCGCCACGTCGTTCAACAACTACATTGCAGAC
GGGGCGAACACGGCGCCGACAGCACTGGCAGAACTGCCGAAGAACATCTCGACGTTGGCGAGCGCGGTGGCCGACATTGT
GCCGAGCGTGAAGGGGATCGCGCGAAGGACAGCAGACGACGACAAGCTGGTGAACGCAGCACGGTTCTCGGCACAGGCGA
CGGCACGATTCTTCCGCAACCTGCAGAGCTGGCGGCTGGACGGACTGGACGCGCTGCAGAAGACGGACGTTGTGATCAAC
GGCAACAACGATGTGCAGCTGGCGCTGCAGTCGCTGAACAAGCTGGTGGACGTGCTGCCACGGGGCTTTACACTGGGCAA
GAGCGGCGACCCGGGCGAGATTGTGGAGCAGGAGCTGGCCAAGGCGATGAAGGCGGTGGAGGCAGCGGCGGCACGACTGG
TGGCTCTGCGAAACAAGCCGCGGGACCCGTTTGCGGCATACGAGGTCAAGGTGCACGAGGCGATCCTGGACGCGGCAGCG
GCAGTGACATCGGCGGTGGCGGAGTTGGTGCGGGCAGCGACGGCGGCGCAGAACGACATTGTACAGGCAGGCAGGGGAGC
ATCGTCGCGGACGGCGTTTTACAAGAAGAACAATCGGTGGACAGAAGGGCTGATCTCGGCGGCCAAGGCAGTGGCGGCAG
CGACGAACACGCTGATCGAGACGGCGGACGGTGTGCTGTCGGGACGCAACAGCCCGGAGCAGCTGATTGTGGCGTCCAAC
GATGTGGCAGCGAGCACGGCGCAGCTGGTGGCAGCGAGCCGCGTGCGGGCGGTCGGCGGAATCGCCAGCCGAACGCAGGA
GGGTCTGGAGACGGCCAGCAAGGCGGTTGGGGCGGCGTGCCGGGCGCTCGTGCGGCAGGTGCAGGCGCTGCTGCGGCCGT
CGGCCGAGGACGCGGTCGACTACTCCAAGCTGGGGGCGCACGAGTTCAAGGTGCGCGAGATGGAGCAGCAGGTGGAGATC
TTGCAGCTGGAAAACGCACTGTCGGCAGCGCGCAGCCGGCTGGGCGAGATGCGCAAGATCTCGTACCAGGAAGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62