GenePrediction:GLEAN_547 Details

Name: GLEAN_547
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:535448..537294 (+ strand)
Length: 1847
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:535448..535904 (+ strand)
Length: 457
Type: CDS
Source: GLEAN
Position: GCSC_97:536305..536323 (+ strand)
Length: 19
Type: CDS
Source: GLEAN
Position: GCSC_97:536853..537035 (+ strand)
Length: 183
Type: CDS
Source: GLEAN
Position: GCSC_97:537102..537294 (+ strand)
Length: 193
>GLEAN_547 class=GenePrediction position=GCSC_97:535448..537294 (+ strand)
ATGAAGCAGCTCAACGACCTTGTACGCGAGTGCACCCGCAACATGTCGGCCGACGCCAGTGGCTTGTGGCTCTCTTGGGA
CGAGCTTGAAGGCGTCCTCCGACGTGTTTTAGACAGGCTTACAGACAAAGGACCTGTTGTGGATAGTGATATTGGCAACA
ATGGCAGCGACAACATTGGCAAACTTTGGCTCCCAACCAAGGTTGCTTTTAGCAGCCCAGTGACAGCCAGTGCAACGTGC
GAAGCGACGAGGAAGAAAGTGTACTATGCCGTGGTTAACCGGATGCTTGTGAACGTTCCACTGTTTCGTGAAGTAGTGCT
GCTACGCGATGAGACGGCTCGCATGCTCGGCTTCCGCCACCATGCTGCTTTAAAGGCGGCAGGTAACATGATGCAGACGC
CCGAAGCTGTGCGTCAGTTGCTGTCCGAGATCTCGGATGTATTGCACCGTTTGGCAAGTGAGAAGGCCTTAGAGTTGCTA
AAGCTGAAGCAAGAAAGAGCAAGGGCCTAGGGTACGGTAGCAGAGGATGAGATTGCGCGCATGCAGGTGTTTTTTTGGGA
CCAGTCGTACCTTGCAAGTCAAGCGAGCGAGAAGGAAAATCCCGCTAAGGCTGCCTTGTCGGAGTACTTTGAGCAGAACA
ACACACTGCAACGACTTCTACAGTTATTCGAGCACCTATTTGGGGCCCGGCTAGTGTCAATCGACACCAGATCCCCCAAC
ATGCCGCAGCATTTGGTATGGCACGACACGATCCTGTTGTTCTCGGCCTGGAACGTCGATGATGAACAGAGCACAAAATT
TCTCGGTTATGCCTATTTTGATTTGATTACACGCGCCAATAATTGAACTCACGTTAGGCATTATCCGCTACCGCAGGTAC
AATGCCCCATGTATTCTTCCCATTCCTCTTTATTCATGTACGCTAATATAATTATCATGGCAGGGCTATGACACACCAAA
TGGTAGTCGTTTCTATCCCTCGTCTGTGTTGGTGATGAACTACATCCAGCCAAGTCAGCAGAAGCCAACGCTCCTACGTA
TAGACGAAGTGCGTAAACTGTTTCATGAACTAGGCCACTTGTTCCATGGGCTTTTATCGTATAGCCAATATGCGGGACTG
CATCGTGTGAAGAGGGATTTTGTCGAAACACCAAGCATGATGTTGGAGCGGTTTTCATGGCAAATGCAGCACATCCGTGA
CGTTTCATGGTACTATTCATACATTGGACCAGAAATGGAGGCCGTCTGGCTGCCTTCCTGCAATCCTGGGAGCCAGAAAT
CGCGACCAGCACCGCAGTTGGACAAAGATCAGGCCGAGCGCCTCGCCTCGGCAAACCAGGCAAAGAATATGCGCGACCAG
CTTAAGGACATCTTCTTCTCGACGCACGACCACCTGGTGCTACAGCCCCGAGACGCACGAAGAGCTTGAGGCGATGAATC
TGACGGAACTCTTCAATCGAACCCGTGCCGACATATACCAGATTCACGGCGGGGAGGCGTTAGACGAGGGTTGGGAATGG
GGCCACGGTGAATCCGTATTTCGAAACGTGCTCAACGGCTACGACGCTGAATACTGCAGCTACATTCTGTAAGTCTTCTG
TTTACCTGATGACATTGACATGGGACATCAATGACTGGTGCTTGTGTGTTTCAGGGGAAGGGTGTTTGCGCTGGACCTGT
TTGACGTCGGGTTCAAGCATGACTCAACAAGCAAAGACGCGGGACGGCGATACCGAGATATGGTGATCGTCAAAGGTGGT
AGCCAGCCGGAAATGAAAACCCTGACGGACTTCTTGGGCCACAGGCCTAGCACGGGGCCTTACCTCGCATGGTTAAGGTC
ACCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62