GenePrediction:GLEAN_5480 Details

Name: GLEAN_5480
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:363607..362628 (- strand)
Length: 980
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:363607..363399 (- strand)
Length: 209
Type: CDS
Source: GLEAN
Position: GCSC_132:363340..363000 (- strand)
Length: 341
Type: CDS
Source: GLEAN
Position: GCSC_132:362935..362628 (- strand)
Length: 308
>GLEAN_5480 class=GenePrediction position=GCSC_132:363607..362628 (- strand)
ATGGATCCTGTCCAATTCTCGGCAATTTTCAACATCAGCATGAACGGGAGCATCGTCAACACGGCGATCGATCCCGTCAT
TCTCACCCAGTTTTGGGAGAGCCTTGCCATCCAGCTGATGCCCGGACGCGATGTAATTGGGATCTCAGGACCTACTTTCC
GCGTTCTCGATGATGGTGGCAAGCAGTTCATTGCTCATCACTTTGCCAGGTAAATTGATATTTTCCAACCTTCCTGTTAA
GTATCTATTCTCATATTTTTTTTTCAGCGCCATTGGAGACACAATGGTGAAGTATGTGATTGACGGAAGCGGCATGCATC
CTGATCGCTACTTCCTGGGCCGTACCAGCTTTTTCCACCCCGAAAATCTGATCTCTCATGCTGGGGAGCTGGACGTCTGG
ATCCCTTCTGGCTATCCTCTGGGGTCGTCTAATTACTCTTTCAACAATGGACAGACCGAAACTCCAGTCGCCCAAAGTAA
CGCTCAACGCACCGGCCGCAATGGAACAGTGAGGATACCGCGCCCACCCAATGCGTACATTCTGTATCGCAAGGATCATC
ACAAGGCTGTTAAGAAGTCTGATCCGGAACTTTCCAACAACGAAATATGTATGCACTCGCCTTGTTCTGAACGCACATCT
TTTTCTACCAGCTTCAATTCTGACTACTGCAGCCGTCATCCTTGGGCGTCAGTGGAACGCCGAGTCTGACGACGTGCGTA
TGCACTATCACACCATGGCCATTGAGATCAAGCGTCAGGTTGAGAGGCTTCATCCTGACTACAGATACAACCCTCGTAGG
TCGTCTGAGATCCGCCGCCGGGCCCGCGGTAATCACGGGGTCTACAATGTCGATGGCACGAACTCAGTTCCAGTTGAGCA
AAACACAGGCAATACCGCTGGCCCGATTGCAGCACCCAGCATCGAATTTTCCATGTCGCCTGGATCCAGTGCCTCCACTG
GCGACGAAGCCGAGACTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62