GenePrediction:GLEAN_5481 Details

Name: GLEAN_5481
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:353056..351370 (- strand)
Length: 1687
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:353056..352951 (- strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_132:352888..352736 (- strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_132:352668..351596 (- strand)
Length: 1073
Type: CDS
Source: GLEAN
Position: GCSC_132:351429..351370 (- strand)
Length: 60
>GLEAN_5481 class=GenePrediction position=GCSC_132:353056..351370 (- strand)
ATGTTGGGTTATCTTATCAATTTTGTGCATCTTGATCCCGGATCTAGGACTGCAGAGGAGAGCGCCCCTGCGTCTGCTTA
CGAGCAGATTGAAAACCTTCGCCGAGGTATGAACAAGCCGACAGATAGGACAGAAGGGTGACCTTTGACCTCAAGCTGAT
GTATGCAGTCATGGACGATCCCGCTTGCCCGCCACTGGTTCTGTCCAGGGACACCGTGCTTTCGCTTGGTCTCAAAGACA
CGCTCCATAGAGCTCAGGTGGCAGAAATCAATATGCGCTCGACAAAGCCTTGGCCCGAGATGCATTCTGGCGCCATTCAT
GGTAAGAAGCGCAGTAGTGCCAGCGACATAGTGAAGAGAATCACTGCTGATGTGAATATCACGAGAAGTTACCGACCGAG
CTGGTGCTTCTGCGCCCCTGATGCACTACATATTCTGGCACCAAGAGACATCTCTGACCCAGCCTGCTTCGCCCAGGCTT
TTGGCGTCGCAAAGCCCCAGCCTCATGGACGAGATTGCCATTCCAGCTGCCATGCAGTCCCTGAACATGAACGCTGGCAC
GCAGCAGGCCACAGACACGGACGGCCATGGAGTGACGCAGCAGACGAAGCCTATCGACATCCGCCAGAACGTGGCAGCTA
CCACTTCTGGCCCTCCCCTGGCAGAGCTTTCGGACACGGAAGTGCTGTCGCATCTGGCTAGGTCGACCCGCCGGATCAAT
ACTCTGCGTGATCCCACGCTTGTCGGTAGGGTCTACAATGATAACTGGCTGGGCAGAATTGTGAACAGCCAGGAAGAGTT
AGACGCAATGGAGAGCTTGGCCAGTATGTCGTCAAGCAATAGCCGTCCCACCGGTAGCCGCGGCGGCCTTCCTGGCTACT
CTCGTCATGGCTTCAGCGATGATGGCGACGCAGAGTATTCGATCAACTCGGGCGACAGTTCCGACTCGGACGACGGTGAT
GTTAAGCGAGAGTCGCTGACACCCGAAACGGCCAGGCGGAGCTGGCGCATCCAGACGGTGACGGCCGATGTGCCAATCCC
ATCGGTGGACGAAGTGTATGCCAGTCCGGCGTATGTTCCTGTGCCGGTTGAGAGGGTGTTCCCCGGCCCCACTGCAAACT
TGCGCCACCAGCAGATGCTTCGCATCCAGCGCCTCCCGCAGCCTCAGAGCCCGCCGATGCGCCAGGCCAGAGATCAGCTG
ACCCACTCGCCCCTGCGGACTTCTTTCTCTGCAAATGGCTACGACGAGGACGCGTCTGGCTCTTCGACCGGCTGGGAGGG
CGAGTGGACACCTTCGAGTTCTCCGGGCTCTCTTACAGGCCCTACTGGGGGTCGTATCACGGGACCTGCGATTGCGCGTG
GCCGCTCTCCCACGAGGGACCACAGTGAGCGCCAATCTGCCAGACACACCCGTCGTCGTGGCAATGCCCCCTATCCCGTG
GACGGGCAATCCGCTCGTCAGGTACGAAGTTAGTCTTCCTTCTGAGTCCTTTGGCGTCGGCGTTGCAACTAACAGAAAGC
AGGGGTGCGACGACGGGAAGAGAAAGTAACGGGCGCCGGTTGGTGCACTGGCTTTTTTGGTGAACTTAATCCGCAGTAGC
ACTCGAGCCAATCGACCTCGTGCTCAGAGCAAGAGCCACAGCAAGAGCCACAGCAAGAAGAGCAGCGGGAAGCATCAGAA
GTGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62