GenePrediction:GLEAN_5482 Details

Name: GLEAN_5482
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:348807..346990 (- strand)
Length: 1818
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:348807..347132 (- strand)
Length: 1676
Type: CDS
Source: GLEAN
Position: GCSC_132:347074..346990 (- strand)
Length: 85
>GLEAN_5482 class=GenePrediction position=GCSC_132:348807..346990 (- strand)
ATGTTCTTCCTTGCTCGTGCTCTGTGTGTGCTGGCACCTCTCACGGTGGTTGTCTTCGTGATAGTGCAAGCCGTGACTCT
GCCACAGCCTCCTCCCAAACCGCTCGTTGCGGTGCCAGCTTTCCGACTATTCCCTCCCAATGCGGCCATTTCTTTGACCG
AAGACAATAGCACCTTCTTCCCGGCCCGGCCTGCAGCGTTCGGGCCTGAGCTACCGGAAATCGGCCTGAGTGCCGTGCTC
TGGATCGGTGCAGGCTTTGGCGAGGACGGTGTGGAGCCGCAGGGCGAGCTTGGTTGCAGCGATGTGCCAGGATGGGACAG
CCGGCGTGCAGCAGACGGGGCGCCCATCCTGCCGACCAAGACGGACCTCGACGATGGCTCGGACAACTACTTGGAGGACT
TTGCCACGGGCCATTACTACGGACAACCGCCCAAGTCCCGCCGTAAAAAGGCCAGCGGCGACAAGAAAAGCCGAACGGTG
GCGGCAGTAGCAGCGGCGGCTGCAGTGGACACGACGCCTGAAGCCGCAGCCACGGGCATTGCGGTAGCGCAAGCGGCCAA
GTCAACGACGGTGCCCAAGGCAAAAGCGGCCAACAAGAACAATGGCAATGAGGGCGGGTCTCGTCACGGCGACATCCAGT
CGCTACAGGAGGGCGCCGAGATTGCGGGGAAGATCGTGCTCCTTAGGCGGGGTGGCTGCGGCTTCTTGGCCAAAGTGATG
TGGGCCCAGCGACGGGGAGCAGTTGCCGTGATTGTGGGCGATGACCGCAAGGGCGGGCCGTTGATCCAGATGTTCGCAAG
CGGCGACACGTCAGACGTGCTGATTCCATCCGTGTTCACAGCACACACTACAGCGCACTTGCTGACGGCGCTGGCAGTGG
ATGCAGTCCGCGAGAGCGATTTGGCAGCAGCAGCGGCAGCAGCAACAAGAGCGGTGGCGGCAGCGGCAGCAGGAGAGGGT
GCTGGGACGAAGACAGGCACACCGACGCCACAGCAGACAGAAGGTGGAGAGCGGCGCGAGTGGGTGCTTGCCGAGTATGT
GCCCACAGACGAGGCCGAGAAGGACAGCGACGAGGGGACGACCGCGTTGGCTGCGCGGATGCGGGTGGCCAAGCAGGCCG
AGTTGATCGGGGCAGCTGACAGCAGAAGCAGCAGTGGACGACAGCTGCTTGTGACGATTGCACCAGCGCGTGGAGGCCTG
CCGCTGATCGACACGCTGCTGGTGCTAGTGGCAAGCCCTCTGCTGGCGATCATGACGATCACATGCGTGCTTCTCTTCCT
GCGGACGCACTGTCGTCATCGAGCATGGCGTGCACCCAAGGCGCTTGTGGACCAGCTGCCGGTGCACATCTACCGGCCGC
CTGGAGCAGCACCGCCGAGCCCGATGATGCTGCCGGTTGGGTCTGAGGTGGCGAGTCCGAATCCATCGCGGCCGTCGTCG
CCGACGCTGAACAGCATGCACCCGACGGTGACGACACCATTGCTTCAGCGGCCGCGCTCGCGAACGACGACAGGAGTGCC
TGGCGACGAGCGCCGTGTCCTGGTGGCGGTGGCGGTGCCGCTGCCACCACCGTCGCGCTACGTCCAGTCGGAGTGCGTCG
TGTGTCTGGAGGACTATGTCGCTGGTGACCGCATCATGAGCCTTCCCTGCGGCCACGAGTTCCACGCGAGCTGCATGTAT
GTTTCCGTTCTTACGACGTTGCTTGTTGCCACGTTTCTCACTAACACAAACAGCATCCCCTGGCTCACGACGAGACGGCG
CACGTGTCCGATCTGCAAGGGCGACATTGTGCGGGCATCTTCAGGCGACGCGGCCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62