GenePrediction:GLEAN_5484 Details

Name: GLEAN_5484
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:334789..332990 (- strand)
Length: 1800
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:334789..334654 (- strand)
Length: 136
Type: CDS
Source: GLEAN
Position: GCSC_132:334605..334501 (- strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_132:334449..332990 (- strand)
Length: 1460
>GLEAN_5484 class=GenePrediction position=GCSC_132:334789..332990 (- strand)
ATGGGCGAGCCAATTCCTCCCAAGCAGAAGAAGTTCAACACTGAGTTGACCGACTACTCTGTCGCCCATGCCGAAAAGAC
AGGCCCCTATGCCGACAATCTCGAGGTCGATGCTCTGATTGTCGGGGCTGGTTTTGGTAGGTCCATCGTCGAGTGAGCAC
TTTGCACGGTCTAACACTAAATAGCCGGCATCTTCATGCTGAAGACGTTGCGCGACCGTGGCCTCAAGGCGGTCATATTC
GAAGCCGGCAGCGGCACCGGAGGCACATGGCGGTGGAATTGCTATCCAGGTAAGCTACCCTCATCCGAACGGTAGAAAGG
CAGCGTGTCTGACTTTTCAGGCGCCGGTGTCGACTCGGAGGTGCCCGAGTACGAATTCTCGTGGCCGGAAGTGTGGAAGA
CGTGGAACTGGAAGACCAACTACCCCGACTACCGGGATCTGCGGGAGTACTTTGACCACGTCGACAAGATCGTCGGCATC
AGCAAGGACACAGCCTTCAACACCGTCGTCGTGGGCGGCCAGTTCGACACGGCGCCTGGCCGCTGGAACATTGAGACGGC
CGACGGCCGCGTCACCAAGGCCAAGTACCTGGTGCTGGGTACCGGCTTCGCCGCCCGCCGTCACATCCCAGCCTGGCCGG
GCATGGACAATTTCCGCGGCGTGCTGCATCACTCGTCCTTCTGGCCCGACAACGACCCTGTCCGCGTCCAGAGCAAGCGC
TGTGCCGTCATCGGCACCGGTGCTTCGGGCGTGCAGATCGTCCAGGCCTGGGGCCCTGTGGCTGAGCAGCTCACCGTCTT
CCAACGCACGCCGAACCTGGCCGTGCCCATGCGCAAGCGTTCGCTGACGGCGGCTGAGCAGGACGCTGCCAAGCACTTCT
ACCCAGAGCTGTTCCGCTACCGCGAGCACAACTTTGCCGGCTTCCTGTACGACTGGATCGAGCGCAACTGCGCCGACGAC
ACGCCCGAGCAGCGCGAGCAGGTCTTTGAGGAGGCCTGGGCTGCCGGCGGCTTCCACTTCTGGGTGGCCATCTACAAGGA
CATCTTTACCAACCCGCAGTCGAACCAGGCCGCGTACGACTTCTGGGCCAAGAAGGTCAGGGCTCGCATCGAAGACCCGC
GGCTGCGCGACCTGCTGGCCCCCCTCAAGATGCCGCACTATTTCGGAATCAAGCGGCCCTGCCTCGAGGGCACGTACTTT
GAACAGTTCAACCGGCCGTCCGTCGACCTGGTCGACGTGCAGAAGAACCCCATCAAGGAGTTCACCGAGACCGGCATCCG
CTTGCAGGACGGCACCGTCCACGAGTTCGACGTCATCGCCGTGGCCACTGGCTTCGACATTGTCACTGGCGTCATGACCC
AGCTAGGCCTCCGCAACATCGACGGCGAGCTGCTCAAGGATCAATGGTCAAAGGGCGCTGAGTCGTATCTCGGCACCACT
GTCAGCGGCTATCCCAACATGTTCCACATCTATGGTTTGCACGGGCCAACGCTTCTCAGCAACGGTCCAACCTCGGTCGA
GGTACAGGGCCGCTGGATTGCCGACACCATCACCAAGGCCGAGGGACTAAATGCCAAGTATATCAACCCCACGGCCGAGG
CCACCCGCAAGTGGAAGAAGCACATTGTGGAAATCAATGACAAAACCCTGTTCCCCACCACCAAGTCCACTTACATGGGA
GGCACCGTTCCCGGAAAGCCTTTCGAGCCGGTTTGTTATGCTGGAGGCATCCCTGCGTATGTGAAGGAAATTCGGGCAGC
CTTGGAGAACATGGAGGGCTTTGAGGTGGTGACGAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62