GenePrediction:GLEAN_5485 Details

Name: GLEAN_5485
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:320268..318646 (- strand)
Length: 1623
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:320268..320002 (- strand)
Length: 267
Type: CDS
Source: GLEAN
Position: GCSC_132:319947..318646 (- strand)
Length: 1302
>GLEAN_5485 class=GenePrediction position=GCSC_132:320268..318646 (- strand)
ATGTATGCCCTTCTTGTGCCAGCTCTGGCAGCTATCGCTGCCACTATGGTCTTTGTCATCCACCCGCTATACGTCTACTT
TCGCGATGAAAAGGACCTCCGAAAATATCCCGCCATGAACTGGCTGGCCGGCATCTCGAACCTAGGCTTCATGTACGAGG
CCGCCGTGGGTTTCCGGTCCGACAAGCTGTACCGGCTGCACCAGATCCATCCAGTCATTCGAACTGGCCCCAATGCTCTC
TCTTTTGCCGGCGGACAGGCCATTAAGGTGAGCCCCACATATTCCTGCTTACATCGTCTTTCTAACACGTCGGGCCCCCA
GGATATCTACGGCCACGGCTCACCCTGCAACAAGGACACGTTTTACTCAACGCTGGCCGGCTCGCATCACCACCTGGCTG
ACGTGGTAGACCGGCCTGAGCACGCACGCAAGCGCAAGGTGCTCTCGGCTGCGTACGCGCTCAAGAACCTGGAGGATTGG
GAGTTCAAGGTGGCCGACAAGACGGAGCGATTTCTGCGGGCTTGCGACCGGGCCTGCACAAAACCTCTTCCAGCAGACAC
ATGCCCAGACGCGGCCGACCTGACGTTTGACTACCGCCAATACACCAATTTCTTCACACTGGACGCGATCGCAGACATTG
GCCTCTCCGAGCGGCTCGGCTTTCTGGACCAGGGCAGCGACGAGTGCGAGGCCGAGGAGATGGATGGCGTAATCAAGCGA
GTGCGCTTCCGCGAGGCTCTGCACGCCACAGGCCTGGCACAGACTCGACTCGTCTGGGCGGCCGGATGGTACGGCTTCAA
CGTGTGGGCGTCTCGGCTGCTGTCACGGCGCTTTCGCCAGCTCTGGCGCCTCAACACGCACTGGAACGGCATCGTGTATC
GGCGGGCTCGTGTACGGCTGGACCGCTACAAAGCCGGCGAGCCGCTCAGCGACTTCTTCCAGAGCCTGATGCACGACCGC
ACCGGCCGGCCGCACGCGCTCGACTGGGGCGAGATCGTGGCCGAGGTGTCCATCATGATGAATGCCGGCTCCGACACGAC
TGCTCTGGCCATGGTCAATGTCATGTACCATCTGCTGCGCCACCCAGACGTTCTGGCGAAGCTGCGCATCGAGGTTGACG
GTGCCCTGCAGCCCGACGAGGTCGTGGCGCCGTACCAAAAGGTCAAGTATTTGCCGTATCTGCGAGCGGTCCTGGACGAG
TCGCTCCGGCTGACACCGCCCACAACGTTTGGCCTACCGCGTCGCACGCCACCCGAAGGCGTTATGGTCGGGTCTGAACA
TATCGCTGGCGACACCACCGTCAGCATCTCGGCCTGGGTGGCCCATCGCGACCCGGTCGTGTTTCCCGACCCCGAGCGGT
TCATGCCCGAGCGCTGGCTCGGTGACGAGGCCAGGGAACTGCAGAGTGGCTTCGTGGCTTTTAGCACCGGTGCACGCGGC
TGCATCGGGCGCAACATCTCGTATCTGGAGCAGACGGTGTTGCTGGCGTCGGTGGTCCACCGGTACGAGCTTGCGCTGCC
GTCGGAGAACTGGGAGCCGGAGCGGTGGGAGACGACCAACTATATGATGAAGGAGATGCCGGTGAAGGTGTGGAGGAGGG
AGGTGGAGTTGAAGGAAGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62