GenePrediction:GLEAN_5488 Details

Name: GLEAN_5488
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:300220..299205 (- strand)
Length: 1016
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:300220..299919 (- strand)
Length: 302
Type: CDS
Source: GLEAN
Position: GCSC_132:299856..299205 (- strand)
Length: 652
>GLEAN_5488 class=GenePrediction position=GCSC_132:300220..299205 (- strand)
ATGCCGTGGAGAGACCAGCTGAAGCGCCTTAAGGGCGAGTTTGAGAGCCGGAAGTCGAAGCCACATGTGGGAAGATCACA
GCAGCAACAGCAGCAACAGCAACAGCAGCAGCAGCAGCCACTGGCAGCCGGCGGACCTGGAGTAGCTTCGGGCGGCGGTG
ATGGGCACCTGTTTGGCCAGCCGGTCTTCCAACCAGACGGGCCCGTGAGCGTCGACTGGGATGCCAAGGTTGGCCATGGC
GAGAATGGCTGGGGGAACCAGGAGCTGCAATTCTACACAGACAGCCCAGAGAACTCGTTCTAGTGAGTGGGGCGTTGGTC
TCAATTCAGACAGTCGCTTAGGGAGGCGCATGCTGACCTCACAGCACCCAAGACGGCAAGCTGGTCATCCGCGCGATCGC
CGACAACAGCACGGCCGACCCGGACCGCCGCTACACGTCGGCGCGTCTGGTCAGCCGCCAGCCTCTCGGCCGCGACCGTG
GCGTGCTGACCGGTCTGGTGCAGTCGCCCTGTGCCGCCGGTATCTGGCCGGCCTTTTGGCTGTTGCCACAGGAGCCGTTT
GCTTGGCCGACCGACGGCGAGATCGATATTGCTGAGACCTGGAACGGCGACGGTGAGAACCGCTCGTGTCTGCACTGGGG
CCATCACCACGAGCAGCAGAAGCACCGCGTCCTGGGTACGCCCATTGCCGACATGCACGCTCGCTCCGTCCGCTATGACT
TTGTCTGGGACCAGCCCAGTGGCATCGCCGGCCACGGCCGTCTTCTCTGGTACCTCGACGGCCGCCCCGTCCTCAAAGCC
GCCGTGCCGTCCGGCACCCGTCCCCTGCGTGAATTTACCATCCTGCTGAACATCGCCATGGGCGGCAACGTCTGCGCCGG
CCACACCCCCGCCGACGGCCGCTACGACCTCGTCGTCGACTCGCTCTTCCTCGCCAGTGAGCAGGAGGACGGCGGCTGGG
CCAAATTTGATGCCGACTGGAACGACAAGAACGTTTCGCTCGGGTACACGTACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62