GenePrediction:GLEAN_5489 Details

Name: GLEAN_5489
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:294203..292852 (- strand)
Length: 1352
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:294203..293067 (- strand)
Length: 1137
Type: CDS
Source: GLEAN
Position: GCSC_132:292884..292852 (- strand)
Length: 33
>GLEAN_5489 class=GenePrediction position=GCSC_132:294203..292852 (- strand)
ATGCTGCAACTATTCGGTCGTCTCCCTATGGAGCTCCGGATTGAGATCTTCTCGTACCTCTTCGAGAAGAAGTGGAATGG
CTGGCGTGCTGACATCCCACGGGAGACGATATCGTATCTATATCGTGAGAGCTCTCTGCGACAGGTTCTCGCCCACTTCT
GCCACAGATTGCTTCGTATCTACGACCTCGATGTCTTTTACGATAAGGCTGTCTTTCTTTCCCGGAAGCCCGACATGGGC
TCTATGCTAAAGGAAATCCGTTTCGACATTGACTTGGGAGAACGGCCCAAGACCGAGCTCTTCTACGAACAGCCCAGCGG
CACTCCCATCAACATCATCCGGATGATAGTCAAATACTACAATGAAGAATGCTCACGCATTCCCCCTAGAAGAAAAAGTC
CGTGGTGGATGGTTCGGGCGACGGCCTTCTATCAAGTATGGCTGACTTGCTTCCTTCGGCGCATACCAGAGGTCGAGTAT
GTCTCTTTACACCTTCCAGAACGAGGAACGATGCCCCTTATCGCCGGCGTGAATGACGACATCGTGTTGCCGGGAGTGGT
GTCTCTTAGCCTTTGGCCCAGTGCCGAATTCAGTCTCCTATTTGATGCGGACTTGGACCTAAACATGGGAAGCGCCATAC
TTCACATGGCTCCGAACGTGGAGACACTGTACATATTCAATCACGCACAGGTTTCTTTGCCTACCGTCTTCACCGACGAA
GGCCTCACTGCAGTTGGCATCACGGCTAAGCTGAATAGGATAAGGCACATCATAATCAGCCTTGAACCTGAACTTCCCTT
GGTGCAGCTCAGCCGGCTTTTCGCCGCGATGGGTCCCAACCTTAGCTCCGTGGAAATCGACTACAGAGTCGGGTTGAGCA
TATGCCATCGTGTGAAGCTTGACATTTCCCTTCGCGACATACTGATCATTCTCTTGCCTTGGCGACATACATTGACGTCA
CTGGAAATCTACGTGGGGAATCATTCGGCTGACAAGCGACGTCTGACGCCAGACGACGACCTTCTACTTCAATTCGATCA
TCTAAAGACACTGTTCGCTGACGAGTTCTCCATCGACATACACACGAGCAGACTGGGATACATGCTTCCAGAGTCTCTCG
AACATCTGAAGGTAAAGGTGAGAATTAAGTATGGATATGAGCTTCCGGGGCTTTTGAGCGTGTTAAGCCAAATCCAGAAA
GGCCGTCTTTCAAATCTACAAGCAGTCGAATTCCATCATTGGAGATCAAACACGGTTGATCCCCATAAGGAACTCGTCGT
TGGATCTAAGACTGTTCGGTACTTTTCCGCCGGTTATAGGGGACCTCGCTAAAGGCGCTCGCTATATCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62