GenePrediction:GLEAN_548 Details

Name: GLEAN_548
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:538196..539847 (+ strand)
Length: 1652
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:538196..538283 (+ strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_97:538373..538898 (+ strand)
Length: 526
Type: CDS
Source: GLEAN
Position: GCSC_97:539034..539847 (+ strand)
Length: 814
>GLEAN_548 class=GenePrediction position=GCSC_97:538196..539847 (+ strand)
ATGGCCGCCACACGTCTCCGCCACACGTTTCGCTACGCAGACGACGAGGACGATCTGTCCGACGGGCCGGAAGTGCTGGA
TGAACAGGGTGAGTGATGGACGGCACAAACACAGCATGAACTCAGCTCCATTCCGTACACATCGCGCCTTCAAACACCAA
ACGGCTGACCGTGTCAGAACAGGATGACCTCATCCAGGCGCTGGCCCAGCAGAACCAGCGGCGCAACGAGCAGTTCCGCC
AGCTGCTGGTGGCCGTCCCCGTCTTGGCCATGGTGCCCTTCCTGATTGCCTGCGTCTCTCCATCGATATCATCGACTCGC
TCCTCTTCCGCCACGATGCTTCCGCTGCTCGGCCTCACATCGCTGGCCGCCACCGCCTATCTGCTGCACCGCCAGCCCGC
CGCGACGACTGGCATCGCCGCTCTGGACGCCTGGAGCGGTGCTGCTCGGTCACCGTCGTCGTCGTCGCCAGCATCGCCGC
TCGATCGACACCTCCCCCTGCTCAACGCCGGTTTGTGCGCCATGCTCCTGCTGTCGCTGCTTCTGCCACGGCCCTCGGCC
GCCGGATCCAGCTCCCTCTCCCGCCAGCTCCTGGCCAGCCTTCCGGCACTCGTCTACAGTGTCGTTCTCGCCGGCAAGGC
CACCATGGCCGGCGTTGACCCCGAGCAGGAGCTCGGTCGCCTTCGCTACGACTACAAGGGGGCGTGAAAATATACAGTGT
GTGTGACACAATCAGCACTGTGCGATGCGTATTTTTACGGCATTCGCCACAAGGCTTCAGACCTGCGCGTTTCACACCAA
GCGAGCCGTCTCCCTCGCGTGTACCCTCCACCAGACAGCCGAACGGACGACGCCATGCCACCACCACAGGCGTCACGCCC
GGCCCTCACGCACTTTCTGTGCATCCCGCTGGGGACGGCCGCCGGCCGGCCGCAGCTGGCCGCCAGCCTGGCGGCTTTCC
ATGCCGACATGGCGGCGACGACGGTGGCCATGACAGAAGGGGGGCCGACGGGGCCGAGCAACCGGGGTGGCGGGACCACC
CGTCGAGGACGGCTGCCGGCCGGAGCACTGCGGCCAGTGGGCACACTGCATCTGACGCTGGGGGTGCTGAGCCTCGGCGG
AGACGGGCGGCTGCAGCAGGCTCTCGAGCGGCTGCAGCAGCTGAAGGAGCTGAACAAGGACGAGGGCGCGGCAGACGTCC
GCGTGGCCCTGCGTGGACTCTACGCGATGCAGCCGCCGTCGCGGGCAGCCGTGCTGTATGCGGCGCCGGTGGACGAGGCA
TCGGGCGTGGTGGCGGGCGGGGCGCTGCTGCGGCTGTGCGAGCGCGTGCGGGCAGCGTTTGCCGATCTGCTCGTCGACGA
CGGCCGGCCGCTGCTGCTGCACGCGACGCTGGTCAACACGGTATACATCCGCAGAGGGGGCCGGGGACGGGGCGGAGGAG
GACGGGGTGGGCGTGGAGGAGGCCGTGGACGCGGAAGAATCCTGTTGGACGCACGTGACATCGTGGAGAGATACGAAGAC
TGCGTGTGGATGGAGCAGGTGCCCGTCGAGACGGTGGCGCTGTGTCGGATGGGGGCGCAGACGTTGGCCGTGGACGACGA
CGGAGAGGTGGTGGAGGCAGCATATCCGGTGGAGGCCGAGGTGAAGGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62