GenePrediction:GLEAN_5491 Details

Name: GLEAN_5491
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:250738..246067 (- strand)
Length: 4672
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:250738..250663 (- strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_132:250597..249155 (- strand)
Length: 1443
Type: CDS
Source: GLEAN
Position: GCSC_132:249094..248855 (- strand)
Length: 240
Type: CDS
Source: GLEAN
Position: GCSC_132:248519..247764 (- strand)
Length: 756
Type: CDS
Source: GLEAN
Position: GCSC_132:247706..246067 (- strand)
Length: 1640
>GLEAN_5491 class=GenePrediction position=GCSC_132:250738..246067 (- strand)
ATGCTTGACCAATACACGTATGTCTTTGTCATCGGCACGCTGTTTGCGCTGCTCGATGCCTACAACAACGGAGCCAGTGA
GTGGTGCGCAGAGAAAGGGTCACCCATACTGAGAAGGCTGACTAAGCCATATCGCCCCCAGACGATGTAGCCAACGCTTG
GGCGACCAGCGTGTCCTCGCGATCGATCAGCTACCGGCAGGCCATGGTCTTTGGGACCGTGTTCGAGATGCTGGGGGCCA
TCTGCGTGGGCGCCCGCACAGCCGACACGATCAAGAACGGGATCATACCGACGTCAGCCTTTCGAGGCGACGCGGGCGTG
CAGATGCTGGCCTTTACGTGTGCACTCGCAGCGGCGTCCTCGTGGGTCATGTGGTGCACACGGCACTCGGCCCACGTGTC
GTCGACGTACTCGCTCATCTCAGCCGTGGCCGGTGTCGGCGTCGCTACCGTCGGGGCCGCCAACGTGCAATGGGGCTGGA
ACAAAGGCAAAGGCATGGGCGCCATTTTTGCCGGACTCGTCATGGCTCCTATCATCGCAGCCGGCTTCGGTGCCATCCTG
TTTCTGCTGATCAAGCTGACTGTGCATGTGCGCCGCCGGCCGGTCCCGTGGGCCGTCTGGACGTCACCCTTTTTCTTCCT
CATCGCCGGCACCATCTGCACTCTTTCCATCGTCTACAAGGGTTCGCCAAGCCTCGGACTTTCCAAGAAGCCGGCCTGGT
ACATTGCTGCCGTCACGATGGGCACCGGCGGCGGTGTTTGTTTGCTGTCGGCCGTGTTCTTCGTGCCCTTTGTACACGCC
TGCGTGATCAAGAAGGATGTCACCGTTCACTGGTGGATGTTTGTGTACGGCCCCCTGCTGTTCAGACGCCCTGCCCCTGA
GGCTGCCGAGAGGGCAATCGTGCCCAACTATGCGGTCGTCCAGGATGACGACGAGGACGAGATTGCACGACAGCAGTGGC
AGACCGCCTCGGCCGGCTCGCTAAGCGACAAGGATGCCCGGGCGACAAAGCAAGTCGACGAGCCCACGACAGAAGCTTTG
GCAGAAGTCGGACAGACGACGTACAAGGAGCTAGTTGCCGCGAACAACGAGCGGTTCCACGCCAAGCTTCGCAAGACAGG
CGGGCCCCTGGGCTGGGCCATGTGCACGCTGCACGACAATCCCATGGGTGCCGGGCAGATCTATGAGGTCAGAAACATCA
AGATGCTGTTCAGGCGACTGCCTGCATATGTCGTCGCCGGCGCCCTCTATGGCTTGCACTATGACATCCATGCGGCTCAG
ACCGGCATCGCTGGCACGCCAGATGGTGAGCGTATGGCGCGCGTGTATGCCCACGCGGAAAAGTACGCCAACGAGGTCGA
GCACACGTACTCGTTCGTTCAAGTGCTGACGGCCTGCACGGCGTCGTTTGCGCACGGCGCCAACGACATTGGCAACTCAG
TCGGCCCCTGGGCTGTCATTTATTCTGCCTGGAAGACGGGCGATGCCGCTGCCTCCAAGGCTCCCGTCCCTGTCTGGCAG
TTGGCCGTCCTCTCCCTGGCTATTTCGCTCGGCCTCATCACGTATGGCTACAACATCATGAAAGGTGAGATCTGCATTCC
TGCCTTTGGGCCAGACGCAAATGCTGGCTAAACATATGGAACAGTTATGGGCAACAAGATAACATACCACTCACCATCGC
GTGGCTGTTCCATGGAAATGGGCGCTGCCATCACCGTTCTTGTCTTCTCGCAGTATTCCCTGCCAGTGTCGACGTCCATG
TGTATTACGGGCGCGACGGTCGGTGTCGGTCTCTGCAACGGCACGTTGAAGGCTGTCAATTTCCACCGCATCGGGCTACT
TTTGCTGGCTTGGATCATGACCATCCCGATTTCAGGAACGCTTGGTGGAATCCTGATGGGGCTTTTCCTAAACGCACCGC
ATTTTTCTTCCTAGGCAGTGTGAATATGCAGAAGTAGATGTTGATTGAACGAAGAGACTGTTGTGTTGCGAAAGAGAGAG
CGAGAGGCTGTCGTGAGAAAGTGACTTCTACGTAGTAATTACGGAGTACAGCACCTTAGTAATACTCTACGCTTACTGTG
GCTTGTGACTGTGGCTAGGATTTGTGACAATTGAGCCCCGCGTTTGAACGCGTTCAATTGCAAAAGCATCGACGTCTGGC
TAACAGCAACGTGACGGCTGCCCGTCGACCGGCCACGATGCGACCGTTTATCTCGCCAGCACGGCTGGTGCTGCTGACGC
TGATTGACATGTACTGCAGCGACGGGGTGGTGCCGGATGCGGACGACGATTTTATCTTGCAGCTGATCGGCAGCTACATG
GCCGACAGCTACGGACAGCCGAGCAGCCGGCGACAGCGCCAGGTGGCGCGGTGGCAGCGAGCGTACCTCAACGTGGACCT
GCTGTCACGGCTGCACAGTCTGCGGGAGCCGCTGCAGGGCTGCTTCGTGGCTTCCAGCGCGGCCGACCTGCCGATGTGCG
CGACGCTCTGGGACACGCTCGTGGCGCGGCTCTGGCTGCGGCTGACCTGCCTGGACGACCTGGTGCCATTCTTCGACGGG
CTTAGCCAGCATGTGGCACCGACATACTCGGAGCTGCGGGCGCGCCGCGAGCTCGGCTTGGAGGACCCGCCTGACCGATT
GCTTCTGCTCGACCGTCGCTCACCCATGGGCCAGCTCGTGTACCAGGCCTGCATCGAGTTTACGCGGCTGTCGTTTTCCG
GTCGCTGCGACCTATGGGAGGACTTTGTGCGCTACCGGAACCCATCGCGGGCTGATTTCAACATCCTCTGGCCGCACGAC
TTTCCCACCGACCGGCTTAGGATGGACGCCGTCTTGACCGAATACCAGGACCAGTGGGGCGACCGGGTCGAGCAGATCGA
GCAGATCACCTTTGACCGCATGCTCAAGGACCGGAGTGTGCCGGCCAGCTCGGACGAGACGGAAAAGCTGGTGTCGCTGC
TGATCGATCGAGAACGTGGGTGCTCTCGGTGTATTGCTCCACTTTGCCTCCTTCCAATGCTGACATAAGCAGGACGAGGT
TTCAGGCCCAGCTACGAACTGCGCAGCGCCACCGACAAGGCCATCGAGGGCTCGACGCTGATCCCGGCACAGACGACGTA
CTACCGCCTAACGGAGGCCTGGCGAATAGGAGACAGCAACACGGCATACGACCAGCTGCACCGATACTTTGACCTGGTGG
CGCGGCAAGGTGTCGGGGCAGCGTTTGGCTACAACATGGGCCCGATGAACAAGGCGATCATGCAGCGCGACTTTGGCGAG
CACCCAGACGACCTGCTATCGATGTTGGATGCGGTGCATGCGGGCCGTGAGTCGCGCGACTACAATTCGCTGCGCTTCTC
GCTGCTGTGGCTGTACCTGTACGCACGCATGATGCCGCGCCACATTCGGCCGCACCAGCTGCAGGGCCTGGCCGGCCAGC
CGACGGACGGCGACCAGGTGCTTCCGTACGTGCGGCACGATGCGCGGATGGCGCAGGCACACGTGCACCGGGCGCTGGCG
TTTGCGCTGGAAGCCCGCGTGGCCCTTGCGGACGGACGGCCGCCTCTGTATGTGCGTGTGTGTCTGCGGGACGGCAGCCG
GCTGACGGTGGGACACAACGAGACGACGCTGCTGGGCCAGCTGGTCAGCACGGCGATGCTGTTCTGGGAGAATGCCGGAG
CGGCCGGGCTGGCGGTCAGCCACGGGCGGGCGTTTCTTCGCACGCGCGAGGACGCCGTACCGTTTGACGACGCCCTGCGT
GTGGCCTCGCGTGTGGCACTGCACTACTGCCATGGAGGGTCCTTTGCGGATGCCCGTGCGGTGCTGCGCCGCCTCAGCTC
CGAGGGTCTCTCGTCGTTACGGCCACAGAGCCGACTGCGTCACGTGCTCACGGTTGTGGCGGCGACAGAAGCCATCCGAT
CCGGTCGATTCGACAAGGCGGATGATCTTTTGCGCCGGTTGCCGGCCGGTGGCTACCCAACGACAGCCAAGGCCAAGACG
TCGCGAGCGTCGCAAGGGCCGTCAGAGCTCGACCCCGACCTGGCGGCGCACGTGGCGCTGCTGCAGATCCAGTCGCTGGC
GCGACGCGGTGAAGGAGCGCTCGTGTTGGCGCGCGACGCGCTCGAGACGCTGGAGACGGCCTACGATGGCGGCGTGGGCG
ACCTGCACGTGCTCATCCGCATGGGGCTTGCGCGCTGTGACCTCTACGCGCGTGCCGGCCGGGCGGTCCGTGGGTTGTCG
GTGGTCATCCGCAGCGTGCAGGCGTGTCTGTGCCGGCGGTACCACCAGCTGCTCTGGGAGGCGGTCGGAGCGCTGGCGCG
GCTTCTCGTGGCCGAGGGCGAGTTTGCGGCCGCGCGCACTCTGCTGGCCGTCGCGATCCCGCGCACGCTGCAGGACCGCG
ACGGCGATCGGACGGCCGAGCTGTACAGCTACCTCGGCGATGCGCACATGGGCATGGCAGGCGAGCTATGGAGGGCGGTG
TCGACGACGACAGCGGCAGCCGAAAAGGACCGACAAAAGGCCAAGATGAAGCGCCACCTGTCCAAGGCGTGGCGCTGTCT
CAAGAGGGCGGAGGAACAGTTTCGGCTGGCCGGGTCGGGCGAGGTGGTGGAAGGGGAGTTTACGATGAAACGAAAGACGA
TTCTGGCCGTGACAAGGCGGCTCAATTCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62