GenePrediction:GLEAN_5493 Details

Name: GLEAN_5493
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:229436..227596 (- strand)
Length: 1841
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:229436..229054 (- strand)
Length: 383
Type: CDS
Source: GLEAN
Position: GCSC_132:228989..228673 (- strand)
Length: 317
Type: CDS
Source: GLEAN
Position: GCSC_132:228605..227596 (- strand)
Length: 1010
>GLEAN_5493 class=GenePrediction position=GCSC_132:229436..227596 (- strand)
ATGAGCGGCCCAATCCCGGATGCCTCCCAAGGCGAAGCGCAAAACAATGGGGTCGAAAAAGAAGCCGTAGTCTTCAGTCG
AAGTGACGAGGATGTCGCTGCCCAGACCACCGTCGGCCTACAGCGCCAGCTCAAAGCCCGTCATCTGAGCATGATAGCAC
TTGGAGGAGCACTGGGAACAGGTCTGGTCATTGGCACAGGTGCTGGCTTGGCTCGAGCCGGTCCGGCTCCCATTCTCATC
ACCTACTCCCTCGTCGGCTTCGTCGTCTACCTCGTCCTCGGCGCTCTCGGAGAGATGGCCACCTGGATTCCCCTCGAGAG
TGGCTTTTCTGGATACACGTCTCGATATGTCGATCCGGCCATGGGCTTTGCTGTTGGCTACTGGTGCGTCTCTCACTTTC
CTGCTACCAAGTCGTGATCAAAACATTATGCTTACGTAATCATACAGCTATTGGTTCAAGTACCTCTTCCTCCCGCCTGC
TCAGCTGACTGCTGCCGCCCTCGTTCTGGAATACTGGGTTCCGCGCGAGCGTGTCAATCCCGGCGTCTGGATTGCCATCT
TCCTCGTCGTTATCGTCTTCATCAATCTTTTTGGCGTCGCTGTCTTTGGCGAGATGGAGTTCTATCTTAGTGCCATCAAG
ATTTTGGTCGTCCTCGGAATTCTCATTCTCTCCCTCATTCTCGTCTGCGGCGGCGGTCCGAATCATCATACCTACGGCTT
CCACTATTGGTCCAAACCTGGAGCGTTTAATCCTTACATCGGGAGTACGTTCCCCGTCTCTTTGCTGTTTTTCGCCTGCG
ATATGTGCATATATATCTAACGTATGAAAAGGCGGAAATTCTGGTCGCTTTCTCGCCATTCTTTCTGTCCTCGTCACCGC
AACTTACGCCTTTCTCGGCACCGAGCTGATCTGCATTACATTCGGCGAGGCCGCGAACCCGCGACGAAACATCCCGCGCG
CCATCCGTCTGACGTTCTACCGCATTCTCGTCTTCTATATTCTCTCTATCCTCTTTCTTGGCATGCTCGTTCCCTACAGC
TCCGATAAACTCAAGACTGCCATCTCGAAATCCACGTCTGCAGACGCCTCGCCCTTTGTGGTGGCCTTCAGAATTGCTGG
CGTCAAAGTTATTCCCGGATTCCTCAACGCATGCTTCCTCATCTTCGTCTTTTCCGCTGCCAACTCTGACCTCTACATCG
CGTCTCGAACCATCTACGGTCTGGCCGCTGAGGGACTCGCACCCCGGTTCCTCGCCCACACCACTCGAAACGGTGTCCCC
ATCTACTCATTACTGCTCTCGAGCGTGTTTGCCTGCATTGGCTTCCTCAATGTTCACACTTCGTCTGCTACTATTTTCAA
CTACTTCACCAATCTGGTAACCGTCTTCGGGATCCTCACCTGGATCTCGGTGCTGGTGACGCATATCTTCTTTGTGCGCG
CACGTCGGGCACAGGGAATTCCCGACTCGTCCCTCAATTATGTCGCACCATTTGGACTCTGGGGAACATATGGTGGCCTT
GCCGTGTGCATCTTCATTGCCTTATGCAAAAACTACAGCGTCTTTGTTCACTCGTCTAAGACAAGCGGTCATTACGGCAA
CTTCGACTATAAGAACTTCATCACTGGCTATCTGGGTATCCCGATATATCTTGTCATGCTTTTTGCGTTCAAGTTCATCA
AGAAATCTAGAGGTGTCGGGCCCCGTGAGGCAGATCTGTTCAGCGGTAAGAAGGAGGTTGATGACGAGGAGATAGAGTAT
CTAGAGCTGGAGAAGCAAGCTGCGAGGGCCAGAGGGACAAACGTTTCGAGGATGTACAGATTTGTTTCATGGCTATTTTA
G

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62