GenePrediction:GLEAN_5495 Details

Name: GLEAN_5495
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:214181..212702 (- strand)
Length: 1480
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:214181..213961 (- strand)
Length: 221
Type: CDS
Source: GLEAN
Position: GCSC_132:213889..213539 (- strand)
Length: 351
Type: CDS
Source: GLEAN
Position: GCSC_132:213475..212924 (- strand)
Length: 552
Type: CDS
Source: GLEAN
Position: GCSC_132:212876..212702 (- strand)
Length: 175
>GLEAN_5495 class=GenePrediction position=GCSC_132:214181..212702 (- strand)
ATGTCAGCTTACCGTATAGGTTTATGGAAACATCCACGCAGTCGTGCTGCTGAATACACCGATATTGAATACTGGACAGA
CCTGGTCAAGATCCTTGAGGCTGGAAAATTCCACGGCCTCTTCCTTGCCGATGTGCTTGGCCATTATGGCGTGTACAAAG
GCCCTTTCAACGTGGACCCAGGCCTTTCAGCGGCTGCACAGTTTCCCATTTCTGATCCGATGTAGGCTGCAATAACCGGT
GCTGCCACAAGTTTGATTGTATACATTTATTCCGCATTCTGACGGTATCCAGGCTACCTGTGTCTGCTATGGCCGCCGTC
ACCAAGCATCTCTCATTTTGGATCACTGCATCTACCACGTACGAGAATCCGTTCTTGCTGGCCCGCCGCTTTGCCACTCT
GGACCATCTTACTAAAGGACGTGTTGCCTGGAACGCGGTGACCAGCCATTTGGCTCCCGCTGCCAAGAATCTCAGCCTAG
ACAAGGAAATTGCCCACGACGAGCGCTATCAGATCGCAGAGGAGTTTCTGACCTTGACTTACAAACTATGGGAGGGCACA
TGGCGTGATAATGCTGTCGTGAAGGATACCAAGACAAAAAAATATGCCGTTCCAGGCCGCGTCCAGGCTATCAACCACGA
AGGGTGAGAAAGGCCGGTACTGCTGGATTCGCTCGCTTGAGTATATACAGTGCTGATTGTGAGCAGAAAATACTTCAAGT
CGGCTGGCCCTCTAACTACTGAGCCCTCCATCCAGCGCACGCCGTTTATCTTCCAAGCCGGTACCAGCAGCGCGGGAAAG
GCGTTCGCCACCAAACATGCCGAGTGCATGTTTCTTCCTGGAATGACGCCAGAGGCTGTCAAGAAGGTGGCCGACGACGT
TCGCCTGCGCGCTGCTGAACAGGGCCGTGATCCGTCTACCCTCCAACTGATAGCCGGCATTATCGTCATCGTCGACGAGA
CAGACGAGAAGGCTCAGGCCAAATATAAGGAGTACTTGTCGTATGCCGACTACGAAGGGTCGCTGGCTCTCTTTGGCGGC
TGGACCGGCGTCGATTTCTCCAATTGGGACGATGATGAGGACTTTACCTTTACGGGGCCAGGATCTATCCAGAGCATGAT
CTCGTCCTGGACAGCAACCATCCTGGGCACAGACGGCGTGCGTTGGACCAAGCGCCGAATTGCTCAAGAGCTAGCCATCA
GTGGTGCCCACAGCCGCATTATCGGCTCGCCAAAGACAGTTGCCGACGCCTTGGAACGGTGGATTGACGAGTCCACCATT
GACGGCTTCAACCTATCATATGCAGTCAGCCCCGGCGACTTGAGGACATCATCCACTGGCTGTTGCCCGAGCTGCGTGCC
CGAGGTGTCTTCTGGGACGATTATATGGCGACCACAACCCGAGAGAACCACTTCCAAGACGGCCTGGGGCCGAGACTGCG
AGACGACCACCCGGGAGCACAGTACAAGTGGAAGGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62