GenePrediction:GLEAN_5496 Details

Name: GLEAN_5496
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:209179..207835 (- strand)
Length: 1345
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:209179..209162 (- strand)
Length: 18
Type: CDS
Source: GLEAN
Position: GCSC_132:208340..208155 (- strand)
Length: 186
Type: CDS
Source: GLEAN
Position: GCSC_132:207873..207835 (- strand)
Length: 39
>GLEAN_5496 class=GenePrediction position=GCSC_132:209179..207835 (- strand)
ATGATTTGCAAATTCAAAGTTGTCGGCAGACGCCGCGTTAGCGTGGCGAGTGTGGGGCGGCTCGTTCACGGCTCTTTATT
AATCCGGCTGCGGACAAGTCACGGGGATGCAATGACAAAAAGAGAAAAAAGAATTTATTTCTCCCCCGGGTGGGTTTGAA
CCACCAACCTTTAGATGGCTACTGATGTTAACAGTCTAACGCGCTATCCAATTGCGCCACGGGGGATTGAATCGTGGTTC
TTGGCTGCAATCAAACCTCGCGAAGGCTGAAGCCGTGAAGAGCGCCAAAGCTTTGACAAGCGCGGATGCCACGAGTGCCG
AGAGCAAGCAGCGGTCGGCCGCGCTAGACGAGCTAGACTACACGGCTGCCGGAAAGCCGTACTTACGGCTCAACCAGGGC
AACGGGGTTATTCAGCAGGCGCCCGGACTCGGAGCCACTGGCGGGTCATACAACCGGAGCAGCGTACGGCTGGGCGACAT
CGACGGCGATGGTCGCCTCGACTACTGTCTGTTAGGACCAATGGAGGGCACTTTGACGTGTCAACACAACGGCGGCACGG
CCGATCCGAGCACGTTTGTCGACCAGCTGGCCCGAGACCCGGTCGGCGTGCAGCTTGCCGACCTTAACGGCGACAGTCGC
GCCGACTGGCTTTGGCTCTACAGCAACGGCCGCATCGACGATCCTGGCCTATGGCCGGCGTGGTGGGACATGGGCGTAAC
CCACGACGGCACGGAGGAACTATCACGTGACATGGTTCGGCTGGCCCGCGTCTTCGGCTCTGGCCGGCTGGACTACGTCT
ATTATTTTGCCACCAACACGACTACGTCTTTGTCGACAGGGCCGGCCAGCCGATCATCTTCCGGAACCTCTTCTGGGAGC
CGGCGACGGCTACGCTGACTACCTCTGCATTTCGCCCGACGACCGCACCACCACCTGGCTACAGGACCCTAGTAGCAGCA
GCCCAAACAGGTTTGTGCCCATCGGTCAGATCGTGTCGTCCCAGACCTCGGACACGGAGCCAACAGTGCGTCGAAAGAAT
ACCTTTACGGAGTTTCATTTGACGACGCATATATACGGGAGCCAGAGACACCACTTCGCAGCGAGTGAGAGAAATTGAAA
CGCAAATTACGAGGGTATTAAGTATGTTGGTGCCGACCAGATAGAGAAGCGGTAAAGGTGTCGCTGTGATTCTCCAAATA
CAAAGAAAACGACCTTTGATGGAAATATCGCTGCAGGATATTGTGCTTTAAATGTCTCAATAATAAGCCAATCAAATCCC
CGACTTCAAGCACGTTATTTTCATAGTCACTCGTCCCCAACAACTTTCCAGCATCGACGCAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62