GenePrediction:GLEAN_5499 Details

Name: GLEAN_5499
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:194948..192883 (- strand)
Length: 2066
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:194948..194703 (- strand)
Length: 246
Type: CDS
Source: GLEAN
Position: GCSC_132:194633..194561 (- strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_132:194470..194461 (- strand)
Length: 10
Type: CDS
Source: GLEAN
Position: GCSC_132:194382..193458 (- strand)
Length: 925
Type: CDS
Source: GLEAN
Position: GCSC_132:193396..193066 (- strand)
Length: 331
Type: CDS
Source: GLEAN
Position: GCSC_132:192989..192883 (- strand)
Length: 107
>GLEAN_5499 class=GenePrediction position=GCSC_132:194948..192883 (- strand)
ATGGACTTCGACCCCAAACACGACTTGTCCCTCAATCTGCCGCTCAGCTTCCCCGGCGATGACGACGGTTCCGAACCGGC
AGAGACGGCCGCCCGGCAACCTCCCCGGCAGCAGACGCAGCGGCAGTCATCCGTACTACACTTCCGCGCCGACGGAAAGG
CCACCGAATCAACGCCGCCTCCACCCACGTTTACTGTTTACATACGCGTACCCGGGCCACGAAATGGCTTTGTCGATCCG
CCAGACGTATGTCCTGGGCGATGCTGCTGATGAACGGGTTGGGATACGGTGTGACTGACAGCTGCACTGTCGCAGATTGA
TTGGAGCAGCGAGAAGGATGACGCTCTGTGGAAAATACTGTCGGGCATGTCCAAGAACGATATTGACTGTACGCCGGCCT
TTTTCTGCTGTGTCATGTTGCTGCTGTTTTTCCGTCTCCCGTCTGTCCACCTGCTGATAAGCTGTGCACATTTAACAGGG
CAGGATCTGTACGGCCACCTTGTCTCTGGCTTTGAATGATTTCTTTCTCCCGCCCCGTCCTCTTCACTGACAACTCATTC
TTTCAGAGCGCAACAGTTCAACGCTACCGTCGAGTTTCTCATCGTGCAGGCCACCATCCTAACCGAGCGCCAGGTCTCAC
AGGTCCGCGCTCAAACCCGGAGGGTGACCAGTCTCGGCGCACGTGACACTCCCGTCAACTCCCCGCTGCTCCCACCCGGC
GAACGGCCTCCGTCTGTTGCCGCACGTGCTGCTACGCCGACGTTGGCATCCGAGGCCATGGGAAGAACCTTGTCAAAAAA
TGGTATGTCCAGGAAGCTGTCGGCCGAGGCCATGCGCCGCACGCCGTCTGGTGGTGGTGCAAACACAAACACCGTTGCGA
GGGTCAGCAATTTCGGCTCTCGTGGCGGATCTCGGCGACCGTCTATGGCGATGGAAGGATCTGCAACCGGTGGCTTCCTG
CCAGCCTCTTCGGCCAAGTTGGCCGCCAACCCTATCGACGGCCGCTTTGCCCGCGTGCGATCCCGGTTTGCTGCCATGTC
CATTGACAGCACACGCGCTCCAACAGATGAGCAGCCGGCAGCAGAAGCCTCATCGACACCCGGGAGACCAAACGCCATTC
GGCACCACAACAAATACGACAGCGAGGATGTCGACGTGCTGTCTCCTGCCGCCACGTCGTCGCAGGCGTCGTCTGATTCC
GAAAGTGACTCGTCCACACCGTCACAGCCTGTCATGTCGCGCATTTTTAAGCGTCCGCCCGGCTACCCACAGCAGGACGA
CTTTGACGCCCATGGCAGTACGGACACGGCGCGTGCCGGTGTCCGAACCACTGGCCGTTATGGCGCTGCGGTTGGCTTGG
GCATAGCCTCACCCGACTCGGCTGGCTCTGACGGTGGAGACGAGTCCGAGACACAGCCGGCCTTCCTGCCTTTCAAGACG
CCCACGCTGGCTGCCACCGTCACTGGCCGGCCTGCCAACAGGGTGAAAAGGGTGTGTATTGCTACCAGACAGACAAACAA
GAGGGAGACTAACCGGCAAATCTTCACGACAGGCCCCGTCGCCGTCGTCCTCGTCCGCCTCTGCCTCCCCGACAACGAAG
ACGTTCAAGAGCCCGGCAGTTGCTACCACTGGAACTAGAGCCATCGTCCAGCCCGGAGTAGCATCGGCGTCTGTTGCCAC
AACAGCCTCGTCACCAGCAGCTGCAGCACGCTTGCATCCCTCTCGGCTGCCCTTGATGCGGGCCTCGCCGTCAACGCTTC
ACCACAACCGCAACCTCTCGGCCGGCCCGAGTCCCGGATCCCGAAGGCGGTCGGGCTACTCACGCGAGGGCAGTGAAACC
GGCACGACGCCCAGCATGGGCAGCAGTTTCAGTGACCTGGACGGTAAGTGGGACTGTACCTTCCTGTTCAGGCTTCAGCG
CTGACTAAGCAGACGTCTCCTTGACTCAATCTGTCCTAGACGAGGCCCTGGCCAGTAGGGTTGAAGACACCAGCTCGGTA
CAGTCCGACGCACAGTCGTCGTCTACCATGGCCTCGTCGTCCACCATGAGTCGACGGCTCCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62