GenePrediction:GLEAN_549 Details

Name: GLEAN_549
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:540601..541991 (+ strand)
Length: 1391
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:540601..540733 (+ strand)
Length: 133
Type: CDS
Source: GLEAN
Position: GCSC_97:540893..541153 (+ strand)
Length: 261
Type: CDS
Source: GLEAN
Position: GCSC_97:541224..541421 (+ strand)
Length: 198
Type: CDS
Source: GLEAN
Position: GCSC_97:541489..541991 (+ strand)
Length: 503
>GLEAN_549 class=GenePrediction position=GCSC_97:540601..541991 (+ strand)
ATGCTCAACCTGGCCGACAGTGATGCGCCGTCGACGGCCCCGGCCGGGATCAGATGCAGGACCACGCCGGCGACGGGCGT
CTCCTCGTCGCACGTCCTGCAAACCACGTCGTCGTCGGCGGCAGTAGCCGGTCGTGTATCTGCCGGCAGAGTGGTCGCCG
CAGCAGTGACGATACCGGCAGCAATGCCAGCAATGCCAGCAACACCAACACCGTCAACATCATCAACACCAACACAAATA
ATCACGCCTATACCAGCACCAACAACATCAACACCAGACACATCTTCATCAGACAAGGACGAGCGCATAGCCCAGCTCGA
GCGCGAGCTGGCCGACCGCACCGACTTCCGTGCCGAATGGGAGACGATAGCAGCACGTGACGAGGAGCTCCGGACACTGC
GGCTGCAGGTGCGTGGGCTCAAGGAGCGAGTCAGCACGGCGACGCGAGCCGAGGGCGTGACCACCAGCGACGAGGTGCTT
GCCGGCGGCATGGCCCGTCTGGCCAACGGGCTGCAAAACTGGGTTATTGTGCACTTTCGGCGTGCGAAGCTAGGTGGGTG
TTTTGCTGGTGCATCCTGTCGTCTTTCCCCTTTTTCCTCTTTCCTCTCTCTAATTTTTTCCAGCACATCCAGACGACTGC
TATGAGCTCACTCAGCTCGTCCCCATGCACGAGCTTTTGCGCCACTCGGCCAAGCTGCACCTGCTGCAGTCTGCCGTCGC
ACGACTGCTGGTCGACCACGTCTTTGCAGCTTACTACGTCGGCCTGTCGTCCGAGCTGGCTGCCCAGCTGTCCCAGATCG
AGGCGGCTCTGCTGTCGTATGGTGCGTCTCCATCTGGTCTCGGGTCCCCCTTGCTCTCCTCGTCCTCTCCTCTCCTCTGA
CCATTTAGCCGGCTCGGCCGGACCCATCAACCAGTGGCGTGCCCTCACCCTGGCCATTGTCAGTAGAGATGCCGCCAAGC
AGCTGCCGCCAGAGACGGATCGCCTGATCGACGATGTGGTGGGGCGCATCAGCAGTGTCCTGGATAGGGCCACGACCACA
ACGACAACCACGTCCACGGACGATCGCAATCAGGCCTTGCGCTTGCTCGTCGCCGGTGCCGTCGATCTGTCGCGCCTCCT
CGTCGCCCAGCGGGCCGTCTTTCGCATCTTCATGCCCAACCCGACGCCACACCAGCAGCTGCTCTTCGACCCGTCCACGA
TGGAGGATCTAGGCTGCGAGGAGGACGATGACGACGGCCTGGCTCGGCGTGAAGTCGCCTTCCTGGCCTTTCCTGGCATC
ATCAAACACGGCGACGAGACGGGCGGCCAGCTGCAATATCGCAACGTCATCTGCAAGGCTCGTGTCACCTGCGCCCGGAA
GGATGAAGAGTCTCAACAAGGAAAAGAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62