GenePrediction:GLEAN_54 Details

Name: GLEAN_54
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:375864..377341 (+ strand)
Length: 1478
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:375864..376567 (+ strand)
Length: 704
Type: CDS
Source: GLEAN
Position: GCSC_179:376645..377341 (+ strand)
Length: 697
>GLEAN_54 class=GenePrediction position=GCSC_179:375864..377341 (+ strand)
ATGGAGGCCGTCATTCCCAGTTATGCCTGCAAGATCAATGGCAGGGATCTCAAGAAAGCTGCAAATAAGAGGGTGGATTC
CCCAATAACGCCCCCTTTCAGGGATGGCCAGGAGATGGAGTCTTTGCTATCTGCGATCTCCGAGAGAGCGTCGCCTTTCC
CCTTCGACGAAGAATCGAATGCCGGGAAGCACCGACTCGCCGATTATTCGCAGAAGAGCCCTGCCAAGCCGATCGCCCCT
GATGAGGCTGCAAAGACGCCTTCCGACGATACAGGAGACAAGGTTGAAGTTTCCAAGACGCAGCAAACAGTGGCGCCTAG
TGATACGAAAGAAGGCAGCTCTACTGGTGTAACCCCGGATGCGGAAAACAACGGACCAGCCGAGAAAGGGGATCATGGGG
AAAAGAATGGCAACAAGCCGGAGCCACCTCTTCCCTCGAACATTCCGGCCCGGCCACCTTCAACGAAATCTCGTAACGCA
AGTTTGTCGCGAGCTGATGGTAGGACTCCAATCGGTGGACATTCTCGAAGCTCAAGCCTGTCGCGGATGTCAATTCCCAT
AGCGGCAAGTCCTAGCCTCTTCTATCGGGAGCCCTTTCATAAGCTATGGCACTCGGAGTCTCCGATATACGTCCCACCAG
GCGGTGTCACGAAGGAAGACCAGCCAACACGACCGGAGAGTGGCAAAGAAATGGTTGAGATAAGGTATGGACGGGACACA
CCTCCCTTTGACGCGAAATGCAAATTAGAGACATGCCGATATGCTAACCACAAATATACAGATCCAGAAATCCAAGCATC
ACCCGCCCTTTATTTGCTTGTATGGCCGCGGGTCCGTCAAATTCCCATCCCTTGGAATTTTCCAGTCGCTCTGTCAGCCG
TGGACGACAGCCCTTGGCAAAGGCAAAGGCAACCGAGGGGGACGTGGCGGCTCTGGTCAATACGAGAACAAGTCGGGCTA
CTGGAAGTGCAGACCGGGGGCGCCAGGCCTCGAACAATCGCAGTATCGTATCACGCGGCGCCATTTCTACGACATCCTCT
GCCTCCTGGCTGTTTGAGACGCCTCCGCTGCGGACACAGCCGGGCTTGGATCCCGACGACGAGATCATTGCTATGATCAG
TCTCATAAGCCGGTCCTGCCCTGTCCACAACCATTCTCAAGTTCAGACACAGGCGCAAGGAAATCAACCTGGTGGATCCA
CGACAACTGCAACTTCAAATGCAGGCGAGCTCGCACCGCACATACCTGTTGTCGGAGGGGCAGAAGACAGCATTTACGAG
GTGTTTTTACCACCCAATATACGCGAGCTGGTAAATTCGTTGCCTAGCTCAGATTCACGAAATCAAGCCACTTTGCGTGG
TCTGGAACTTGCCAGAAATCGCGAGTCTCCGAAATTCGACCCGCCTACACCAACGGCTATGCAATATGATGTCAGCTTGA
AAGACGAGAAAAACATTCGACGAGTCTCTTCTGTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62