GenePrediction:GLEAN_5500 Details

Name: GLEAN_5500
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:190362..188939 (- strand)
Length: 1424
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:190362..189369 (- strand)
Length: 994
Type: CDS
Source: GLEAN
Position: GCSC_132:189318..188939 (- strand)
Length: 380
>GLEAN_5500 class=GenePrediction position=GCSC_132:190362..188939 (- strand)
ATGAAGGCCGAGAACAACGACGCAGTCTGGGTACATCCGCCTGCCGGCGATGTCGACGAGGAAGCCCAGGCGGACGTGGT
TGACAAGGAAGAAAGCGGCGACACGGACGCGACCCTTCAGACGGAGGCGGCAGGGCCACAAGTGCCAGTGGTCAAGAGCT
CAGGGCCGCCACCCAACGGTGGTCTCTGGGCATGGCTGCAGGTGGTGGCAGCCTTTAGCATCTTCTTCAACACCTGGGGG
GTGCTCAACACGTTTGGCATCTTCCAGACATACTACGAGACAGGCGCACTCTTTTCCGAGACGTCGTCCAATATTGCATG
GATCGGCGCGATCCAGGCCTACTGCACCGTCTCGCTAGGCCTGGTGGCTGGCCCCATCTATGACCGCGGCCATCTGTCCG
GCCTGCTGATCGTGGGCACCTTCCTGGTCGTCTTTGGCTTTATGATGCTGAGCATCTGCACGGCCTTCTGGCAGGTCGTT
TTGGCCCAGGGTTTCTGTGTCGGCATCGGCGCCGGCATGCTCTTCGTGCCATCACTGGCCCTGTTGCCGACGTACTTTTC
GTCGCGGCTCGGCCTCGCCGTCGGCCTGGCTGCTTCGGGCTCGTCGCTCGGAGGCGTTGTCTACCCCATTGTCTTTTACC
GCCTCATCGGCCGCATCGGCTTCGGCTGGACCGTGCGTGTCATCGCCTTCATCTCTCTCGCCACACTGCTCGTGCCCTTG
TCGGTGGCCCGGCAGCGCGTCCGACCGTCGCAGGCCCGTGCCCTGCTCGACTGGACCGTCCTGCGCGACCTCCCCTTTCT
CGTCTTTACCTTTGCCACACTGCTCGGCTTCAACGGCCTCTACGTCATGCTCTTCTACCTCTCGTACTATGCCGGTGAGT
CGGGCTCTACCTCGGCAGAAATGGCCTTTTACATTGTGCCCATTCTCAACGCTGCCTCCATGTTCGGCCGGACTATCCCC
AACTACGTTTCCGACAAGACGGGGCCAATTAACTGTAAGTCTTCCGGCGCTTCTCCCCGTCTACTGACCCCGCTGATAGC
CTAGTGTTCGGTCCGGCTGCCATCGTCTGTTCCGTGCTCACCTTTTGCATGATCGCCGTCAAGGACCTTGCCGGCGTCGT
TGTTGTCGCCATCCTCTTTGGCTTTTTCTCTGGCGTCTTCATCGCCCTTCCTGGAGTCTGCTTCGTTCATCTGACTGCGG
ACAAGTCTAAGCTGGGCACCCGTATGGGCATAGCCTTTGCCACCCTTGGCTTTGGCGTGCTGACCGGAGGGCCTGGTACC
GGCGCCATTATCGGCTCTGATGACACTGACCTGCATTGGACCAGCGCCTGGGTCTTCGGCGGCTGCACCATGGCAGGGTC
TGCTGTTATGTTGATAGCTCTGAGACTTTACCTAACTAAAGGGAAATTGGCAGTCAAGATATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62