GenePrediction:GLEAN_5502 Details

Name: GLEAN_5502
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:184666..182971 (- strand)
Length: 1696
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:184666..184430 (- strand)
Length: 237
Type: CDS
Source: GLEAN
Position: GCSC_132:184359..183686 (- strand)
Length: 674
Type: CDS
Source: GLEAN
Position: GCSC_132:183619..182971 (- strand)
Length: 649
>GLEAN_5502 class=GenePrediction position=GCSC_132:184666..182971 (- strand)
ATGGCGACTTTTGTCGACGAGAAGCACGGACGACAGGCCCAGGCCGAGACAATAGTGCCGCTTGGCGGGAGCACCAGCGT
TGAAACGGGCACTGACCATGGCGGCCAGCGCAAACGAAGCACCTGGCACAAGGTGCAGGCGATTATCTGGGACAATCCGG
ACAAGCCCGCAGCGGAAAAGAAGTTTCTGCGTAAGCTGGACTTTTACCTGTTGACCTACACGTGTCTGGGATACTTTGTA
AGTACTCGAATATGTGCCCTTATGGCGCCAATGTGTCTTGCCGTCCGTCCTGACCCTCTGGCTACAGTGCAAGAATCTCG
ACCAGGCCAACATCAACAACGCATACGTGTCGGGAATGAAAGAGACCATCCATTTGGGCGGCAATGACCTGACATATGCA
GGCAACTGCTTTACGGCTGGCTACGTGATCATCCAACTGCCCATGGTCATTCTGGTTACCAAGATCCGGCCCTCATACGT
GATCCCGACGCTCGAGGTCCTCTGGTCCGTCTTCACCTTTTGCTCGTCGGCCGTCAAGACGCCGGCGCAGCTCTATGCCA
TGCGCTTTCTTGTCGGCTTCTGCGAAGGCGCCTTCTTCCCCTGCATCATGTACCTGATCGGCTCTTGGTACACGCGCGCG
GAGCGGGCCAAGCGCACCACCATCTTCTACTCGACCGCCTCGGCTGCGTCCATGTTCTCGGGCTACCTACAGGCTGCTGC
CTACGACAACCTCGACGGCGTGCTCGGCCACCAGGGCTGGCAATGGTTATTTATCATCTGCGGTATCATTTCGCTACCGG
TGGCAATAATAGGCTACTTTTTTAACCCAGATTTTCCTGAGACGACGCGTGCATTTTACATCTCGCCCGACGAAGCCGCC
TTTGCGCGTCAACGCCTCATCGATGACGGCTACAAGCCGCTTGGTGCGTCTGCCTGGACCAAGACCAAAATCTTCGACAT
CATACTGTCATGGCAATTCTGGTGAGTCGCCTCCTACAATTTGTCTCGTTGGGCCCTTTTGATGTTTCCGTCATCTCACA
AGACCAGGGTTCTCTCGGCTGGGTACTTCTTCGTCCAGAGTGGCTATCCCTCGCAACAGCCATTCTACTCACTATGGCTC
AAGTCCACCGGCCACACGACCTACCAGGTCAACGTGTGGCCAACGGGCCAGCACGCCATCGGCTGGGTGACGCAGATCGT
CGCCGGCATCCTGTCGGACTCGCCACTGCTGAACGGCCGGCGCTGGCAACCGCTTGTGGCGCTGCAAGGCATCAGCGTAT
TTGCCAGCATCGTGCTGGCCGTCTGGGACGTGCCGATCGGTCTCAAGTATGCTGCCATGTATCTGACCAGCACGGCAGCC
GGCGTGCCCGGTATATATTACGCCTGGTTCCCTGACCTCATGCCAGACGACCACGAGAAGCGCGGCTTCCTCATCGCCTT
CTCCAATGTCTTTTCCTACGTCAACCAAATCTGGTACACCGACGCATTCTGGCGCACCAGCGAGAAGCCACGCTTTCACC
CGGGCTTCATCGCTTCCGCCACCTTCGGATGGGTCCTCATCCTCACTGCTATACTGATGCACTTCCTCGAGCTGCACGAC
ACTAGAGTCCGCAGACGGGCCAACGCTCTTACTGCTGAGCCGCCCGTAGATAGTCACCCACCAACGCTAACATCGTCGGT
GCCCGCTAGCGTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62