GenePrediction:GLEAN_5503 Details

Name: GLEAN_5503
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:182150..180842 (- strand)
Length: 1309
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:182150..181902 (- strand)
Length: 249
Type: CDS
Source: GLEAN
Position: GCSC_132:181837..181724 (- strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_132:181609..180842 (- strand)
Length: 768
>GLEAN_5503 class=GenePrediction position=GCSC_132:182150..180842 (- strand)
ATGGTGCTCACTCCGCAAAACGTGGGCGCAAAGGGCGTTCCCTACTTCATCCCCGTCCAGGACCCCCCGGCTGGCACGGC
CAAGCTGCCTGAGAATGGCAAGCTGCCAAAGCTGTTCACCCCGCTGAAGATCCGGGGGGTCACACTGCCCAACCGGGTCT
GGGTCAGCCCGATGTGCCAGTACAGCGGAAAAGAGGGCTTCACCGGCCCCTGGCACTTTGTCCACTACGGTGCCCTGACC
ACACGCGGCGTGAGTTGCTGCTTGGAGCCATGTCTGGCCTTCCCGTCCGCTGAGCTGCCGGTCTAACCTCCAGGAACAGC
CTGGATTCACCATGACAGAGGTTGCTGCCGTTGCCGACATTGGCCGCCTCACGCCCGAAGACCTTGGCATCTGGCTGGAC
GCCCACATCAAGGGTTTGCGCAAGATTGTCGACTTTGCCCACAGCCAGAGCGCACTGATAGGCATCCAAATAGGCCATGC
CGGCCGTAAGGCCTCGGCTGTGGCTCCGTGGCTGGGCGCCGGCATCTCTGAGGAAGCTTAGGGTGGCTGGACGGATCGCG
TGGTCGGACCCGACGGCCGCCCGTTTTCCGACTCGCCCGATGACACGATCGTGCCACACGCCCTGACCCTGGCCGAGATC
GCCCAGATTCGCAAGCAGTTTGTCGTCGGCGTCCAGCGCGCCGTCCTAGCCGGTTTCGACATCATCGAGCTGCACTTCGC
CCATGGCTACCTCGTGTCCAGCTTCATGTCGCCAGCTACGAACCAGCGCACTGATCAGTATGGCGGCAGCTTCGAGAACC
GCGTCCGGCTTGCCCTCGAGATCGTCGAGGACGTCCGCGCCGTGCTGCCCGATTCCACGCCGCTGTTTGTGCGCATCAGC
GCGACTGACTGGCTGCATAAAAACCCCGACTACCACGGTGCCAACTGGAACGTCGAGGAGAGCGCCCAGCTGGCCGTCCT
GCTGGCTGATCGAGGTGTCGATGTCTTGGACGTCTCCTCCGGTGGCATCCACATCGCCCAGAACGTCAAATCCAGCCCGG
CCTACCAGACCCCACTCGCCAAGCACATCAAGAAGGTCGTTGGCGACCGCCTGCTTGTCAGCACCGTTGGCAGCATTCGC
AGCGCCAAGGCTGCCGAAGAAATCCTTAACGGCGGCAAGGACGCTGAGGACCCGCCTCTCGACCTTGTTGCTCTAGGCCG
TCCTTTCCAGAAGAACCCTGGGGTCGTCTGGGAATGGGCTTCTGAGCTGGAGACTCGTGTCAAAGTGGCCAGTCAGATTG
GTTGGGGCTTTGGTTTGAGCTCGTTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62