GenePrediction:GLEAN_5504 Details

Name: GLEAN_5504
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:180065..179394 (- strand)
Length: 672
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:180065..180002 (- strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_132:179944..179394 (- strand)
Length: 551
>GLEAN_5504 class=GenePrediction position=GCSC_132:180065..179394 (- strand)
ATGCACCAGCCGGACAAAGAGGACCAGTTGTGGTCATCAGAGTACACTGTCAGAGGGGAGTCTAGTAAGTTTTTGTCCAG
GCTCTATGTAAGGTAAACAAACAGTTGACACAGCTCACCAGATTACCTCCACCGAATGTACTACTTCCTGCATCGATTCG
GTCTACAATCCAACATTATATGCTCAGCACGATACAAATCAGACGAGCGGGACGCCATTATCGACAGATCAAAGCTCTAT
GCTGTCCTGAAATCGATCATCGACCAGTACCCAGAATTGGCCATCGTCGGGGTCATGGAATCGTCGCCCAAGCCGGGCCG
TTACCGACTTCGACGAGCCCTCCTCCACCGCATCCATCTGCACACCTGCACTGAGTTTATCGAGACGCAAGACGGAGTCA
GCCCGGACCTTCTCGAGCGGCTGCATGGCGAGTGGCTGTGGACGGCAGCGAAGCCAGACAAGCCGTGGTGGAAGGTGGTT
GTGGTCAACGGGCAAGATGTTGTCTTTGTCTTCCACCACTTTGTCTGCGACGGCCGGTTCGGCTACCTGTTCCACAAAGC
ATTTGCAGAGGCTCTCAACGCCATGCCCCGGCCCTCTGCATCACCTGCCCCCATGACGGACACCGTTGAAGTCGACGCAG
CCAAGGCCCCCCATTGCAACAATGCTGGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62